View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_182 (Length: 229)

Name: NF0908_low_182
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_182
NF0908_low_182
[»] chr1 (1 HSPs)
chr1 (12-100)||(37167112-37167201)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 12 - 100
Target Start/End: Original strand, 37167112 - 37167201
Alignment:
Q  12 tattgcatatttatatacctagctaa-ttgtattaaattaactatttatgcagggttcaaaatctggtcgagagagaaaaacggtgtatt 100  Q
    |||||||||||||||||| | ||||  ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  37167112 tattgcatatttatatactttgctagcttgtattaaattaactatttatgcagggttcaaaatctggtcgagagggaaaaacggtgtatt 37167201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University