View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0907_low_21 (Length: 214)

Name: NF0907_low_21
Description: NF0907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0907_low_21
NF0907_low_21
[»] chr4 (1 HSPs)
chr4 (1-117)||(9866681-9866797)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 9866681 - 9866797
Alignment:
Q  1 agaccagtgccacaattgcaagctctttcactaccttctgtatttcgcattctttcttcatggcaattctcaacctttgatatcactacctcaccattta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9866681 agaccagtgccacaattgcaagctctttcactaccttctgtatttcgcattctttcttcatggcaattctcaacctttgatatcactacctcaccattta 9866780  T
Q  101 tatttcctcgagattca 117  Q
    |||||||||||||||||    
T  9866781 tatttcctcgagattca 9866797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University