View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0905_low_38 (Length: 290)

Name: NF0905_low_38
Description: NF0905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0905_low_38
NF0905_low_38
[»] chr2 (1 HSPs)
chr2 (96-241)||(40311721-40311867)


Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 96 - 241
Target Start/End: Complemental strand, 40311867 - 40311721
Alignment:
Q  96 tttgtattgcacgcatatcgatttctcaaaacagagctttcttttttagttcaattcatttacgtaattgtccttgttgtttgtttctaatgacatg-tt 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  40311867 tttgtattgcacgcatatcgatttctcaaaacagagctttcttttttagttcaattcatttacgtaattgtccttgttgtttgtttctaatgacatgttt 40311768  T
Q  195 acatagccctacactactcatgtcattttcaacgttcaccacctttg 241  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||    
T  40311767 acatagccctacactactcatgtcattttcaacattcaccacctttg 40311721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University