View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0903_low_43 (Length: 233)

Name: NF0903_low_43
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0903_low_43
NF0903_low_43
[»] chr1 (1 HSPs)
chr1 (20-147)||(16645185-16645312)
[»] chr8 (3 HSPs)
chr8 (27-145)||(1520838-1520961)
chr8 (27-145)||(1516652-1516776)
chr8 (99-145)||(23087298-23087344)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 20 - 147
Target Start/End: Complemental strand, 16645312 - 16645185
Alignment:
Q  20 aggtcttaatcttgatttaagttcttcaatatcctaacatagaggctaaaataaatgatggataatcataggcaaacacttgggaattttgcaatggtag 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  16645312 aggtcttaatcttgatttaagttcttcaatatcctaacatagaggctaaaaaaaatgatggataatcataggcaaacacttgggaattttgcaatggtag 16645213  T
Q  120 cattactctttcttggttttattttcat 147  Q
    ||||||||||||||||||||||||||||    
T  16645212 cattactctttcttggttttattttcat 16645185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 27 - 145
Target Start/End: Complemental strand, 1520961 - 1520838
Alignment:
Q  27 aatcttgatttaagttcttcaatatcctaacatagaggctaaaataaa-----tgatggataatcataggcaaacacttgggaattttgcaatggtagca 121  Q
    ||||||||||||| || | |||||||||||||||||||  || | |||     |||||||||||| ||||||||| ||||||| ||||||||||||||||    
T  1520961 aatcttgatttaatttgtacaatatcctaacatagaggtaaagaaaaaaataatgatggataatcttaggcaaacccttgggagttttgcaatggtagca 1520862  T
Q  122 ttactctttcttggttttattttc 145  Q
    ||||||||| ||||||||||||||    
T  1520861 ttactctttattggttttattttc 1520838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 27 - 145
Target Start/End: Complemental strand, 1516776 - 1516652
Alignment:
Q  27 aatcttgatttaagttcttcaatatcctaa-catagaggctaaaata-----aatgatggataatcataggcaaacacttgggaattttgcaatggtagc 120  Q
    ||||||||||||| || ||||||||||||| ||||||||  || |||     ||||||||||| || ||||||||||||||||| |||||||||||||||    
T  1516776 aatcttgatttaatttgttcaatatcctaaacatagaggtaaatatagaattaatgatggatagtcttaggcaaacacttgggagttttgcaatggtagc 1516677  T
Q  121 attactctttcttggttttattttc 145  Q
    |||||||||| || |||||||||||    
T  1516676 attactctttgttagttttattttc 1516652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 145
Target Start/End: Original strand, 23087298 - 23087344
Alignment:
Q  99 ttgggaattttgcaatggtagcattactctttcttggttttattttc 145  Q
    ||||| ||||||||||||||||||| ||||||  |||||||||||||    
T  23087298 ttgggtattttgcaatggtagcattgctctttggtggttttattttc 23087344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University