View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0903_low_28 (Length: 312)

Name: NF0903_low_28
Description: NF0903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0903_low_28
NF0903_low_28
[»] chr2 (1 HSPs)
chr2 (121-179)||(30742005-30742063)
[»] chr8 (1 HSPs)
chr8 (121-178)||(17109644-17109701)


Alignment Details
Target: chr2 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 121 - 179
Target Start/End: Complemental strand, 30742063 - 30742005
Alignment:
Q  121 tgccaacaaatgctagtattaactcgagacaatgagtgcatctcttgagtaataccaca 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30742063 tgccaacaaatgctagtattaactcgagacaatgagtgcatctcttgagtaataccaca 30742005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 17109701 - 17109644
Alignment:
Q  121 tgccaacaaatgctagtattaactcgagacaatgagtgcatctcttgagtaataccac 178  Q
    |||||||||||  |||||||||| |||||||||||||| ||||| | ||| |||||||    
T  17109701 tgccaacaaattatagtattaacacgagacaatgagtgaatctcattagtgataccac 17109644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University