View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0900_low_48 (Length: 288)

Name: NF0900_low_48
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0900_low_48
NF0900_low_48
[»] chr1 (1 HSPs)
chr1 (95-240)||(17587747-17587893)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 95 - 240
Target Start/End: Complemental strand, 17587893 - 17587747
Alignment:
Q  95 ttacaactttatcaaaatcaaattttttgactaaagcatagtcgagttgttctggtnnnnnnnnn-taacatctaacaaaacactcacatagaaattgaa 193  Q
    |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||          ||||||||||||||||||||||||||||||||||    
T  17587893 ttacaactttatcaaaatcaaattttttgattaaagcataatcgagttgttctggtaaaaaaaaaataacatctaacaaaacactcacatagaaattgaa 17587794  T
Q  194 gactccggctgcttcaggttttgctctttgctcgtccgtggtcctat 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  17587793 gactccggctgcttcaggttttgctctttgctcgtccgtggtcctat 17587747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University