View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0885_low_47 (Length: 206)

Name: NF0885_low_47
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0885_low_47
NF0885_low_47
[»] chr1 (1 HSPs)
chr1 (1-119)||(6319822-6319940)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 6319822 - 6319940
Alignment:
Q  1 ttaagcgaagatgatggcgatcacaaaacaggcatattgagtggtatgagtagcccttcaagcggcgatgatgatcgcaaaaggcagtcaatactatcag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  6319822 ttaagcgaagatgatggcgatcacaaaacaggcatattgagtggtatgagtagcccttcaagcggcgatgatgatcgcaaaaggcagtcaatactgtcag 6319921  T
Q  101 ctgatcaagaaactgatga 119  Q
    |||||||||||||||||||    
T  6319922 ctgatcaagaaactgatga 6319940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University