View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0883_low_13 (Length: 344)

Name: NF0883_low_13
Description: NF0883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0883_low_13
NF0883_low_13
[»] chr3 (1 HSPs)
chr3 (22-344)||(29405135-29405466)
[»] chr7 (1 HSPs)
chr7 (57-116)||(19911363-19911422)


Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 22 - 344
Target Start/End: Complemental strand, 29405466 - 29405135
Alignment:
Q  22 catcatcaccttcctcataatcatcatcagaaaaatcttcctcatcacttaatatataccttgacccttccaaccccatctctctatcagtctcccctaa 121  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29405466 catcttcaccttcctcataatcatcatcagaaaaatcttcctcatcacttaatatataccttgacccttccaaccccatctctctatcagtctcccctaa 29405367  T
Q  122 caaatccatcaacgacatcgtcggaggtcctg---cagcctcggcctcagcctc------cgctgcagcttctgctgcttcttgtgccgccactgcttct 212  Q
    ||||||||||||||||||||||||||||||||   |||||||||||||||||||      ||||||||||||||||||||||||||||||||||||||||    
T  29405366 caaatccatcaacgacatcgtcggaggtcctgttgcagcctcggcctcagcctcagcctccgctgcagcttctgctgcttcttgtgccgccactgcttct 29405267  T
Q  213 ctcgccgataatgccctccccgtctctggatgcttggtatcatcgtcgggctcctcatcgtcgaagctgtctcgaaaagtcactacacgcccttttcgga 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29405266 ctcgccgataatgccctccccgtctctggatgcttggtatcatcgtcgggctcctcatcgtcgaagctgtctcgaaaagtcactacacgcccttttcgga 29405167  T
Q  313 atggatctgccgatgacacgttggtggaattc 344  Q
    ||||||||||||||||||||||||||||||||    
T  29405166 atggatctgccgatgacacgttggtggaattc 29405135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 57 - 116
Target Start/End: Original strand, 19911363 - 19911422
Alignment:
Q  57 tcttcctcatcacttaatatataccttgacccttccaaccccatctctctatcagtctcc 116  Q
    ||||| |||||||| ||  |||||||||| |||||||| |||||||| ||||||||||||    
T  19911363 tcttcttcatcactcaaagtataccttgatccttccaatcccatctccctatcagtctcc 19911422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University