View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0882_high_10 (Length: 235)

Name: NF0882_high_10
Description: NF0882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0882_high_10
NF0882_high_10
[»] chr4 (3 HSPs)
chr4 (137-189)||(5159303-5159355)
chr4 (144-189)||(5181531-5181576)
chr4 (144-178)||(5172339-5172373)


Alignment Details
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 137 - 189
Target Start/End: Complemental strand, 5159355 - 5159303
Alignment:
Q  137 aagtctaaaattcttggagaatcctagatgacaaattggtatgggaatatgat 189  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  5159355 aagtctcaaattcttggagaatcctagatgacaaattggtatgggaatatgat 5159303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 144 - 189
Target Start/End: Complemental strand, 5181576 - 5181531
Alignment:
Q  144 aaattcttggagaatcctagatgacaaattggtatgggaatatgat 189  Q
    |||||||||||||||||||||||| |||||||||||||||||||||    
T  5181576 aaattcttggagaatcctagatgagaaattggtatgggaatatgat 5181531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 178
Target Start/End: Complemental strand, 5172373 - 5172339
Alignment:
Q  144 aaattcttggagaatcctagatgacaaattggtat 178  Q
    |||||||||||||||||| ||||||||||||||||    
T  5172373 aaattcttggagaatccttgatgacaaattggtat 5172339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University