View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0876_low_31 (Length: 217)

Name: NF0876_low_31
Description: NF0876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0876_low_31
NF0876_low_31
[»] chr8 (1 HSPs)
chr8 (1-147)||(3238493-3238639)


Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 3238639 - 3238493
Alignment:
Q  1 ttaagaagaaactgtgctatatatgtatacggtaattctcaatcaattacaggttgatcgagctgtgacactcgccatttctcaaaatgaagggttaccg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3238639 ttaagaagaaactgtgctatatatgtatacggtaattctcaatcaattacaggttgatcgagctgtgacactcgccatttctcaaaatgaagggttaccg 3238540  T
Q  101 tatacatatacagcacagtttcgatcgagctgtgacctatgatactc 147  Q
    |||||||||||||||||||||||||||||||||||||| ||| ||||    
T  3238539 tatacatatacagcacagtttcgatcgagctgtgacctgtgacactc 3238493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University