View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0875_low_85 (Length: 204)

Name: NF0875_low_85
Description: NF0875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0875_low_85
NF0875_low_85
[»] chr1 (1 HSPs)
chr1 (1-60)||(46494522-46494581)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 46494581 - 46494522
Alignment:
Q  1 aacaccatcattcatcatggtttcatccaacaaggtattattcttattcctcttcatctc 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46494581 aacaccatcattcatcatggtttcatccaacaaggtattattcttattcctcttcatctc 46494522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University