View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0874_low_44 (Length: 288)

Name: NF0874_low_44
Description: NF0874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0874_low_44
NF0874_low_44
[»] chr5 (1 HSPs)
chr5 (1-36)||(39731815-39731850)


Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 39731850 - 39731815
Alignment:
Q  1 agtaaaaaaggtagaagcttttttgttgttaacata 36  Q
    ||||||||||||||||||||||||||||||||||||    
T  39731850 agtaaaaaaggtagaagcttttttgttgttaacata 39731815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University