View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0870_high_5 (Length: 264)

Name: NF0870_high_5
Description: NF0870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0870_high_5
NF0870_high_5
[»] chr8 (8 HSPs)
chr8 (30-264)||(13025023-13025257)
chr8 (34-224)||(18096280-18096470)
chr8 (167-224)||(12712113-12712170)
chr8 (34-142)||(18081854-18081962)
chr8 (167-216)||(6117562-6117611)
chr8 (163-224)||(18139784-18139845)
chr8 (166-222)||(12724620-12724676)
chr8 (169-216)||(12705461-12705508)
[»] chr1 (2 HSPs)
chr1 (165-237)||(17747850-17747923)
chr1 (164-231)||(22535498-22535565)


Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 8)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 30 - 264
Target Start/End: Complemental strand, 13025257 - 13025023
Alignment:
Q  30 ttattatcccttagaatttcgaagtggtgattgggtttatttgccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgac 129  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13025257 ttattatcccttagaatttcgaagtggtgattgggtttattttccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgac 13025158  T
Q  130 agtttttgggaggnnnnnnngctcatattcaacttgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatggggttg 229  Q
    |||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13025157 agtttttgggaggaaaaaaagctcatattcaacttgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatggggttg 13025058  T
Q  230 atatgcctgcttcttgcccacattctctcgtgaac 264  Q
    ||||||||||||||||||||| |||||||||||||    
T  13025057 atatgcctgcttcttgcccacgttctctcgtgaac 13025023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 34 - 224
Target Start/End: Original strand, 18096280 - 18096470
Alignment:
Q  34 tatcccttagaatttcgaagtggtgattgggtttatttgccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgacagtt 133  Q
    |||||||||||||||  | ||| ||||||||||| ||| ||| |||||||||| |||||||||||||  ||||| ||| | || ||  |||||||| |||    
T  18096280 tatcccttagaatttgaaggtgatgattgggtttgtttaccgaacaaggatgaccctttttgggagactgatgtacacaaccttgacatgaatgacggtt 18096379  T
Q  134 tttgggaggnnnnnnngctcatattcaacttgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatgg 224  Q
    |||||||||       ||||||  |||| |||||||| || || | |||||| |||||||||||  || |||||||||||||||| |||||    
T  18096380 tttgggaggagaaggggctcattgtcaagttgtatgaaccattttgggagatgtatagcctcaagcgtgattcttggaggaaacttgatgg 18096470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 167 - 224
Target Start/End: Complemental strand, 12712170 - 12712113
Alignment:
Q  167 atgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatgg 224  Q
    |||||||||||| |||||| ||||||||||||||||| |||||||||||| |||||||    
T  12712170 atgaccctttctgggagatatatagcctcaaaagtaactcttggaggaaaatcgatgg 12712113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 142
Target Start/End: Original strand, 18081854 - 18081962
Alignment:
Q  34 tatcccttagaatttcgaagtggtgattgggtttatttgccggacaaggatgatcctttttgggagagagatgtgcacgagctggatttgaatgacagtt 133  Q
    |||||||| ||||||  | ||| ||||||||||| |||||||||||||||||| |||||||||||||  ||||| ||| | || || |||| ||||  ||    
T  18081854 tatccctttgaatttgaaggtgatgattgggtttgtttgccggacaaggatgaccctttttgggagattgatgtacaccaccttgacttgattgacgatt 18081953  T
Q  134 tttgggagg 142  Q
    |||||||||    
T  18081954 tttgggagg 18081962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 6117562 - 6117611
Alignment:
Q  167 atgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaa 216  Q
    |||||||||||| |||||| ||||||||||||||||| ||||||||||||    
T  6117562 atgaccctttctgggagatatatagcctcaaaagtaactcttggaggaaa 6117611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 224
Target Start/End: Complemental strand, 18139845 - 18139784
Alignment:
Q  163 ttgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatgg 224  Q
    |||||||| ||||| | |||||| ||||| ||||||||| |||||||||||||||| |||||    
T  18139845 ttgtatgaacctttttgggagatatatagtctcaaaagtgattcttggaggaaacttgatgg 18139784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 222
Target Start/End: Original strand, 12724620 - 12724676
Alignment:
Q  166 tatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgat 222  Q
    ||||| || |||| |||||| |||||||||| |||||| ||||||||||||||||||    
T  12724620 tatgaaccattcttggagatatatagcctcagaagtaactcttggaggaaactcgat 12724676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 12705461 - 12705508
Alignment:
Q  169 gaccctttctcggagatttatagcctcaaaagtaattcttggaggaaa 216  Q
    |||||||||| |||| | ||||||||||||||||| ||||||||||||    
T  12705461 gaccctttctgggagttatatagcctcaaaagtaactcttggaggaaa 12705508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 165 - 237
Target Start/End: Original strand, 17747850 - 17747923
Alignment:
Q  165 gtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaac-tcgatggggttgatatgcct 237  Q
    ||||||||||||||  ||||| |||||||||| |||||| ||||||||||||| || |||||||||||||||||    
T  17747850 gtatgaccctttctgtgagatatatagcctcataagtaactcttggaggaaacttcaatggggttgatatgcct 17747923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 164 - 231
Target Start/End: Complemental strand, 22535565 - 22535498
Alignment:
Q  164 tgtatgaccctttctcggagatttatagcctcaaaagtaattcttggaggaaactcgatggggttgat 231  Q
    ||||||||||||| | |||||| || ||||| | |||||| |||||||||||||| ||||| ||||||    
T  22535565 tgtatgaccctttttgggagatatacagccttagaagtaactcttggaggaaacttgatggtgttgat 22535498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University