View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0860_high_14 (Length: 229)

Name: NF0860_high_14
Description: NF0860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0860_high_14
NF0860_high_14
[»] chr4 (1 HSPs)
chr4 (128-216)||(51767044-51767132)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 216
Target Start/End: Complemental strand, 51767132 - 51767044
Alignment:
Q  128 agaaaagttgaaaccgataagaacnnnnnnncaagagccccatataaaaacttaaaagagaaaagaccggatttgttaagagtccgagt 216  Q
    |||||||||||||||||||| |||       ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  51767132 agaaaagttgaaaccgataataactttttttcaagagccccatataaaaacttaaaagagaaaagaccggatttgtcaagagtccgagt 51767044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University