View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0857_low_139 (Length: 202)

Name: NF0857_low_139
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0857_low_139
NF0857_low_139
[»] chr1 (1 HSPs)
chr1 (19-181)||(40590869-40591031)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 19 - 181
Target Start/End: Original strand, 40590869 - 40591031
Alignment:
Q  19 gacaaaaatctagttgaaacacaagatgaagaacatattgatttacaagaccgaattggtgagttcatggatattgtactttgtacaaatataaaactgg 118  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  40590869 gacaaaaatctagttgaaacacaagatgaagaacatgttgatttacaagaccgaattggtgagttcatggatattgtactttgtacaagtataaaactgg 40590968  T
Q  119 aactttattttctgcttatttattgaatatgtattttagtttttccatcattgtctttactct 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40590969 aactttattttctgcttatttattgaatatgtattttagtttttccatcattgtctttactct 40591031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University