View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0857_high_112 (Length: 214)

Name: NF0857_high_112
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0857_high_112
NF0857_high_112
[»] chr2 (1 HSPs)
chr2 (24-135)||(35417929-35418040)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 24 - 135
Target Start/End: Complemental strand, 35418040 - 35417929
Alignment:
Q  24 tgaagcacatcatgttaattagtgagaggagcaaaaccagcatatggtaaccgatacacccgccgggttacattctgatccattataaggcaaccacgtg 123  Q
    |||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35418040 tgaagcacatgaggttaattagtgagaggagcaaagccagcatatggtaaccgatacacccgccgggttacattctgatccattataaggcaaccacgtg 35417941  T
Q  124 acttctgaaact 135  Q
    ||||||||||||    
T  35417940 acttctgaaact 35417929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University