View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_low_226 (Length: 239)

Name: NF0856_low_226
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_low_226
NF0856_low_226
[»] chr4 (1 HSPs)
chr4 (154-206)||(49321205-49321257)


Alignment Details
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 49321205 - 49321257
Alignment:
Q  154 agcagagagtattaatgtgcattttattgatgctaaaatttatgcaatttttt 206  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  49321205 agcaaagagtattaatgtgcattttattgatgctaaaatttatgcaatttttt 49321257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University