View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_high_47 (Length: 440)

Name: NF0856_high_47
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_high_47
NF0856_high_47
[»] chr8 (143 HSPs)
chr8 (29-306)||(43347920-43348197)
chr8 (307-382)||(2733615-2733691)
chr8 (305-385)||(3054021-3054101)
chr8 (305-382)||(14188087-14188165)
chr8 (306-382)||(25250783-25250860)
chr8 (306-382)||(36586480-36586557)
chr8 (310-382)||(37295128-37295201)
chr8 (307-382)||(4430788-4430864)
chr8 (307-382)||(6317299-6317375)
chr8 (307-382)||(19649551-19649627)
chr8 (307-382)||(27928157-27928233)
chr8 (307-382)||(34711608-34711684)
chr8 (305-382)||(25199043-25199121)
chr8 (305-382)||(38070534-38070612)
chr8 (306-382)||(4977087-4977164)
chr8 (310-378)||(26690696-26690765)
chr8 (306-382)||(38953533-38953610)
chr8 (307-382)||(11100341-11100417)
chr8 (307-382)||(24654973-24655049)
chr8 (310-385)||(25213631-25213707)
chr8 (307-382)||(26737970-26738046)
chr8 (307-382)||(43820867-43820943)
chr8 (311-382)||(44814866-44814938)
chr8 (312-382)||(9569728-9569799)
chr8 (309-382)||(6845036-6845110)
chr8 (305-382)||(7772103-7772181)
chr8 (311-380)||(10096615-10096685)
chr8 (306-382)||(2442760-2442837)
chr8 (307-382)||(25063338-25063415)
chr8 (310-382)||(25893853-25893926)
chr8 (306-382)||(31639155-31639232)
chr8 (306-382)||(33067441-33067518)
chr8 (306-382)||(37708500-37708577)
chr8 (307-382)||(4312132-4312208)
chr8 (307-382)||(17649895-17649970)
chr8 (306-380)||(37817374-37817449)
chr8 (306-382)||(8569943-8570020)
chr8 (306-382)||(9998696-9998773)
chr8 (310-382)||(23681012-23681085)
chr8 (307-382)||(24242638-24242715)
chr8 (307-379)||(35421674-35421747)
chr8 (307-378)||(40744299-40744371)
chr8 (307-382)||(41562441-41562517)
chr8 (308-382)||(403666-403741)
chr8 (306-369)||(34143421-34143484)
chr8 (310-369)||(34540131-34540190)
chr8 (306-369)||(35810235-35810298)
chr8 (307-376)||(8547189-8547259)
chr8 (306-379)||(20990469-20990543)
chr8 (305-382)||(34744319-34744397)
chr8 (313-382)||(44604874-44604944)
chr8 (310-382)||(14243701-14243774)
chr8 (306-382)||(26226765-26226841)
chr8 (307-382)||(5704681-5704757)
chr8 (307-382)||(5895848-5895924)
chr8 (311-382)||(10617788-10617860)
chr8 (307-382)||(16395372-16395448)
chr8 (306-369)||(4694754-4694817)
chr8 (310-369)||(26675559-26675618)
chr8 (313-379)||(32922930-32922997)
chr8 (310-365)||(39666966-39667021)
chr8 (305-382)||(18040133-18040211)
chr8 (306-368)||(20150219-20150281)
chr8 (311-382)||(16501651-16501724)
chr8 (306-382)||(27544969-27545046)
chr8 (307-382)||(27849796-27849872)
chr8 (308-369)||(41746715-41746776)
chr8 (306-377)||(15129635-15129707)
chr8 (307-382)||(21530779-21530855)
chr8 (307-382)||(35222272-35222348)
chr8 (313-379)||(5700705-5700771)
chr8 (332-382)||(6436707-6436758)
chr8 (305-382)||(2589285-2589363)
chr8 (307-369)||(13634845-13634907)
chr8 (307-369)||(13735258-13735320)
chr8 (307-369)||(20662521-20662583)
chr8 (319-380)||(36372078-36372140)
chr8 (319-380)||(40999764-40999826)
chr8 (306-382)||(2527200-2527277)
chr8 (306-382)||(24241951-24242028)
chr8 (382-423)||(32526582-32526623)
chr8 (306-378)||(40344488-40344560)
chr8 (307-382)||(29158797-29158873)
chr8 (313-380)||(37953788-37953856)
chr8 (307-382)||(38017227-38017303)
chr8 (306-369)||(2508201-2508264)
chr8 (305-382)||(11564996-11565075)
chr8 (314-369)||(34642504-34642559)
chr8 (321-382)||(8525254-8525316)
chr8 (307-369)||(38216822-38216884)
chr8 (311-380)||(41278604-41278674)
chr8 (307-360)||(11265132-11265185)
chr8 (311-379)||(12702354-12702423)
chr8 (307-364)||(22762003-22762060)
chr8 (330-382)||(27817502-27817555)
chr8 (307-364)||(42650167-42650224)
chr8 (313-380)||(5682278-5682346)
chr8 (311-378)||(6602575-6602642)
chr8 (311-378)||(6678028-6678095)
chr8 (313-349)||(7432582-7432618)
chr8 (307-382)||(10286518-10286594)
chr8 (307-382)||(11098127-11098203)
chr8 (310-369)||(16816827-16816887)
chr8 (307-382)||(20993536-20993612)
chr8 (306-350)||(23554868-23554912)
chr8 (310-358)||(41897826-41897874)
chr8 (313-379)||(10006151-10006218)
chr8 (305-378)||(29845142-29845216)
chr8 (307-380)||(31941089-31941164)
chr8 (306-369)||(45406321-45406384)
chr8 (313-382)||(1766713-1766783)
chr8 (307-380)||(3728381-3728455)
chr8 (306-348)||(23872799-23872841)
chr8 (310-364)||(29513878-29513931)
chr8 (310-378)||(30089960-30090030)
chr8 (313-382)||(31261008-31261078)
chr8 (307-365)||(39333944-39334002)
chr8 (338-382)||(40772618-40772663)
chr8 (310-382)||(42922541-42922614)
chr8 (313-381)||(43129101-43129170)
chr8 (313-356)||(1522697-1522741)
chr8 (316-382)||(3673896-3673964)
chr8 (311-378)||(12534775-12534842)
chr8 (306-385)||(36482106-36482186)
chr8 (311-378)||(42192696-42192763)
chr8 (332-382)||(17919868-17919919)
chr8 (313-358)||(40216783-40216830)
chr8 (313-376)||(43330622-43330684)
chr8 (313-377)||(5917286-5917352)
chr8 (316-369)||(25899249-25899303)
chr8 (320-358)||(35497714-35497752)
chr8 (311-365)||(39303313-39303366)
chr8 (332-369)||(10926153-10926190)
chr8 (307-356)||(24420067-24420116)
chr8 (313-380)||(28183766-28183835)
chr8 (311-356)||(28817260-28817304)
chr8 (311-356)||(32333118-32333162)
chr8 (313-380)||(40418132-40418201)
chr8 (311-378)||(70580-70647)
chr8 (311-378)||(4531039-4531106)
chr8 (315-382)||(12927279-12927347)
chr8 (347-382)||(36055508-36055544)
chr8 (332-368)||(36442755-36442791)
[»] scaffold0432 (1 HSPs)
scaffold0432 (307-385)||(9366-9445)
[»] chr2 (106 HSPs)
chr2 (307-385)||(32023251-32023330)
chr2 (306-382)||(35476543-35476620)
chr2 (306-382)||(38490453-38490530)
chr2 (307-382)||(12236120-12236196)
chr2 (307-382)||(15897213-15897289)
chr2 (307-382)||(20251538-20251614)
chr2 (307-382)||(23080151-23080227)
chr2 (307-382)||(34667043-34667119)
chr2 (307-382)||(36754794-36754870)
chr2 (308-382)||(39070019-39070094)
chr2 (306-382)||(7975067-7975144)
chr2 (306-382)||(13268028-13268105)
chr2 (310-382)||(34481724-34481797)
chr2 (306-382)||(40592311-40592388)
chr2 (306-382)||(42007268-42007345)
chr2 (307-382)||(2287362-2287438)
chr2 (307-382)||(6731541-6731617)
chr2 (307-382)||(10392644-10392720)
chr2 (307-382)||(42160310-42160386)
chr2 (306-380)||(33607041-33607116)
chr2 (310-382)||(43461387-43461460)
chr2 (306-382)||(44948017-44948094)
chr2 (305-382)||(4014866-4014944)
chr2 (307-369)||(7958051-7958113)
chr2 (305-382)||(42200915-42200993)
chr2 (306-382)||(727342-727419)
chr2 (306-382)||(23497565-23497642)
chr2 (306-382)||(23957050-23957127)
chr2 (306-382)||(43035438-43035515)
chr2 (306-382)||(45049383-45049460)
chr2 (307-382)||(3048541-3048617)
chr2 (311-382)||(24381248-24381320)
chr2 (307-382)||(35687839-35687915)
chr2 (307-382)||(40812016-40812092)
chr2 (307-369)||(4772302-4772364)
chr2 (306-379)||(41164704-41164778)
chr2 (306-382)||(18368792-18368869)
chr2 (306-382)||(18999327-18999404)
chr2 (306-382)||(28855467-28855544)
chr2 (321-380)||(41196976-41197036)
chr2 (306-369)||(31054046-31054109)
chr2 (307-377)||(35706851-35706922)
chr2 (310-382)||(11543852-11543926)
chr2 (306-378)||(15488747-15488820)
chr2 (306-382)||(16534996-16535073)
chr2 (306-382)||(23458678-23458755)
chr2 (323-378)||(15920671-15920727)
chr2 (307-382)||(16010666-16010742)
chr2 (311-378)||(32120613-32120680)
chr2 (311-382)||(34242504-34242576)
chr2 (307-382)||(36794803-36794879)
chr2 (310-369)||(16368755-16368814)
chr2 (310-380)||(38463141-38463212)
chr2 (310-365)||(42133513-42133568)
chr2 (306-380)||(42211276-42211351)
chr2 (332-382)||(42414529-42414580)
chr2 (305-359)||(11816853-11816907)
chr2 (305-382)||(31516258-31516336)
chr2 (313-382)||(38140696-38140766)
chr2 (303-360)||(433133-433190)
chr2 (305-381)||(11061380-11061456)
chr2 (307-366)||(7607310-7607370)
chr2 (311-378)||(19048758-19048825)
chr2 (306-380)||(19134571-19134647)
chr2 (305-380)||(31525007-31525083)
chr2 (307-382)||(39218680-39218756)
chr2 (314-379)||(12221200-12221267)
chr2 (307-380)||(8859342-8859416)
chr2 (313-367)||(31819643-31819697)
chr2 (315-376)||(39417449-39417511)
chr2 (307-379)||(4695048-4695121)
chr2 (307-379)||(11011975-11012047)
chr2 (311-356)||(25510382-25510427)
chr2 (310-382)||(39310368-39310441)
chr2 (311-378)||(10639663-10639730)
chr2 (311-382)||(18779914-18779986)
chr2 (311-378)||(33083611-33083678)
chr2 (313-379)||(16178264-16178331)
chr2 (337-382)||(8532135-8532181)
chr2 (305-382)||(12541389-12541467)
chr2 (308-354)||(18469514-18469560)
chr2 (306-376)||(5887569-5887637)
chr2 (311-356)||(11708682-11708726)
chr2 (306-378)||(12847012-12847085)
chr2 (336-380)||(13622983-13623028)
chr2 (313-354)||(19967739-19967780)
chr2 (322-382)||(37198784-37198845)
chr2 (332-380)||(37644288-37644337)
chr2 (307-364)||(42030243-42030299)
chr2 (311-356)||(45125245-45125289)
chr2 (311-378)||(11459719-11459786)
chr2 (307-351)||(29741043-29741087)
chr2 (307-369)||(499824-499887)
chr2 (313-364)||(7315833-7315884)
chr2 (308-378)||(11816608-11816678)
chr2 (313-377)||(13491030-13491096)
chr2 (320-369)||(33898242-33898292)
chr2 (308-358)||(43696410-43696460)
chr2 (320-369)||(11091653-11091702)
chr2 (306-377)||(18055856-18055929)
chr2 (311-356)||(26605628-26605672)
chr2 (313-377)||(39831501-39831565)
chr2 (318-363)||(44887134-44887179)
chr2 (311-378)||(7275943-7276011)
chr2 (305-349)||(21840536-21840579)
chr2 (308-356)||(25501863-25501910)
[»] scaffold0402 (1 HSPs)
scaffold0402 (305-382)||(1294-1372)
[»] chr3 (145 HSPs)
chr3 (305-382)||(8381076-8381154)
chr3 (306-382)||(13525167-13525244)
chr3 (307-382)||(4232230-4232306)
chr3 (307-382)||(4833162-4833238)
chr3 (307-385)||(6583285-6583364)
chr3 (305-382)||(29212118-29212196)
chr3 (306-382)||(4976761-4976838)
chr3 (305-382)||(6083195-6083272)
chr3 (306-382)||(24650600-24650677)
chr3 (307-382)||(3917765-3917841)
chr3 (306-385)||(24250723-24250803)
chr3 (307-382)||(32961031-32961107)
chr3 (306-380)||(30553023-30553098)
chr3 (306-379)||(41464662-41464736)
chr3 (306-381)||(28171033-28171110)
chr3 (311-382)||(11312593-11312665)
chr3 (307-378)||(27396853-27396925)
chr3 (306-385)||(28266524-28266604)
chr3 (307-382)||(38127895-38127971)
chr3 (307-382)||(43605629-43605705)
chr3 (307-382)||(43898016-43898092)
chr3 (305-369)||(46838794-46838858)
chr3 (307-382)||(54097493-54097569)
chr3 (307-377)||(22371449-22371520)
chr3 (304-382)||(35069309-35069388)
chr3 (313-382)||(10473967-10474037)
chr3 (306-382)||(47069004-47069082)
chr3 (306-378)||(2687557-2687630)
chr3 (306-382)||(2789031-2789108)
chr3 (311-382)||(40840171-40840244)
chr3 (311-382)||(1242220-1242292)
chr3 (307-382)||(27002793-27002869)
chr3 (305-380)||(34397677-34397753)
chr3 (307-382)||(35359716-35359792)
chr3 (305-382)||(15003625-15003703)
chr3 (307-369)||(17500926-17500988)
chr3 (305-382)||(32590969-32591047)
chr3 (305-382)||(42296709-42296786)
chr3 (307-380)||(46894812-46894886)
chr3 (307-369)||(53583960-53584022)
chr3 (306-382)||(8507930-8508007)
chr3 (307-382)||(11029662-11029739)
chr3 (307-382)||(11751210-11751287)
chr3 (306-382)||(24910341-24910418)
chr3 (306-382)||(25118759-25118836)
chr3 (307-382)||(24657410-24657486)
chr3 (307-378)||(24751752-24751824)
chr3 (307-382)||(37124215-37124291)
chr3 (306-382)||(44107379-44107455)
chr3 (307-378)||(47410809-47410881)
chr3 (306-369)||(10047870-10047933)
chr3 (310-380)||(12948812-12948883)
chr3 (306-379)||(19921368-19921442)
chr3 (305-378)||(40193013-40193087)
chr3 (319-382)||(3440736-3440801)
chr3 (307-364)||(47408839-47408896)
chr3 (310-382)||(50238893-50238966)
chr3 (307-382)||(10228956-10229032)
chr3 (307-382)||(14868908-14868983)
chr3 (305-365)||(24273951-24274011)
chr3 (307-382)||(44037497-44037573)
chr3 (310-378)||(46311502-46311569)
chr3 (311-382)||(53669764-53669836)
chr3 (331-385)||(9609955-9610010)
chr3 (310-369)||(48191096-48191155)
chr3 (325-382)||(28197037-28197095)
chr3 (306-382)||(8826623-8826700)
chr3 (319-382)||(1218424-1218488)
chr3 (307-367)||(2900254-2900314)
chr3 (307-378)||(11249959-11250031)
chr3 (307-371)||(18271576-18271640)
chr3 (305-380)||(23878943-23879019)
chr3 (308-379)||(37312528-37312600)
chr3 (305-369)||(40559671-40559735)
chr3 (307-382)||(48555835-48555911)
chr3 (310-385)||(51112514-51112589)
chr3 (307-369)||(9583490-9583553)
chr3 (311-382)||(44879287-44879358)
chr3 (306-382)||(8792782-8792860)
chr3 (307-349)||(21402745-21402787)
chr3 (305-382)||(28731844-28731922)
chr3 (310-364)||(41921508-41921562)
chr3 (306-382)||(12088335-12088412)
chr3 (306-382)||(38085804-38085881)
chr3 (306-382)||(43426566-43426643)
chr3 (310-382)||(43967926-43967999)
chr3 (311-382)||(52256805-52256878)
chr3 (307-382)||(19961368-19961444)
chr3 (306-382)||(32946406-32946482)
chr3 (307-382)||(40418528-40418604)
chr3 (308-379)||(40639602-40639674)
chr3 (316-378)||(16687606-16687668)
chr3 (306-365)||(17373669-17373728)
chr3 (328-382)||(33886423-33886478)
chr3 (315-369)||(2558754-2558808)
chr3 (333-382)||(8128343-8128393)
chr3 (310-382)||(9493499-9493573)
chr3 (333-382)||(35240055-35240105)
chr3 (334-382)||(2096638-2096687)
chr3 (311-376)||(35755735-35755800)
chr3 (311-364)||(42482999-42483052)
chr3 (311-378)||(4601429-4601496)
chr3 (307-382)||(5998835-5998909)
chr3 (316-379)||(7552603-7552667)
chr3 (311-378)||(7824511-7824578)
chr3 (311-378)||(29689539-29689606)
chr3 (306-380)||(30703088-30703164)
chr3 (310-369)||(43904562-43904622)
chr3 (311-378)||(51665982-51666049)
chr3 (311-378)||(54151738-54151805)
chr3 (311-378)||(54158270-54158337)
chr3 (316-382)||(32635387-32635454)
chr3 (311-358)||(45475310-45475357)
chr3 (307-366)||(46828893-46828952)
chr3 (311-377)||(52500842-52500908)
chr3 (313-382)||(33746030-33746100)
chr3 (311-380)||(36540108-36540178)
chr3 (323-382)||(1562809-1562870)
chr3 (306-382)||(47570281-47570358)
chr3 (309-369)||(35208132-35208192)
chr3 (311-374)||(36518103-36518167)
chr3 (311-378)||(41377588-41377655)
chr3 (313-365)||(46316548-46316600)
chr3 (310-380)||(21569261-21569332)
chr3 (315-377)||(25312984-25313047)
chr3 (313-379)||(32956775-32956842)
chr3 (305-364)||(39172037-39172096)
chr3 (332-382)||(48209484-48209535)
chr3 (313-367)||(9318523-9318577)
chr3 (306-379)||(18462012-18462086)
chr3 (308-377)||(27719174-27719244)
chr3 (313-382)||(29216811-29216881)
chr3 (311-365)||(46800103-46800157)
chr3 (337-377)||(2947778-2947819)
chr3 (308-379)||(10071572-10071645)
chr3 (311-364)||(21893322-21893375)
chr3 (336-369)||(34481859-34481892)
chr3 (323-364)||(43357235-43357276)
chr3 (316-380)||(44791717-44791781)
chr3 (339-382)||(5349971-5350015)
chr3 (323-382)||(6419718-6419778)
chr3 (319-378)||(36229051-36229110)
chr3 (311-378)||(42392862-42392929)
chr3 (307-351)||(49285507-49285551)
chr3 (305-365)||(54950032-54950092)
[»] chr1 (118 HSPs)
chr1 (305-382)||(10635486-10635564)
chr1 (305-382)||(19338231-19338309)
chr1 (305-382)||(48391953-48392031)
chr1 (306-382)||(29005088-29005165)
chr1 (307-382)||(43676077-43676153)
chr1 (305-382)||(40958627-40958705)
chr1 (307-382)||(48314166-48314242)
chr1 (306-380)||(42631040-42631115)
chr1 (306-368)||(28999372-28999434)
chr1 (307-382)||(270374-270451)
chr1 (306-382)||(17068150-17068227)
chr1 (307-379)||(49948240-49948313)
chr1 (307-382)||(43086524-43086600)
chr1 (304-382)||(15906220-15906299)
chr1 (316-382)||(20164126-20164193)
chr1 (307-369)||(40809280-40809342)
chr1 (310-382)||(3315796-3315869)
chr1 (306-382)||(4126573-4126650)
chr1 (310-378)||(24119658-24119727)
chr1 (307-382)||(5598300-5598376)
chr1 (311-382)||(13555777-13555849)
chr1 (305-380)||(32880634-32880710)
chr1 (311-382)||(48731809-48731881)
chr1 (307-382)||(49500860-49500936)
chr1 (305-382)||(13018070-13018148)
chr1 (313-382)||(15331115-15331185)
chr1 (310-382)||(11403171-11403244)
chr1 (306-378)||(18475107-18475180)
chr1 (306-382)||(21522315-21522392)
chr1 (306-382)||(34010092-34010169)
chr1 (310-382)||(41445083-41445156)
chr1 (307-382)||(18089821-18089897)
chr1 (307-378)||(25821007-25821079)
chr1 (311-380)||(39606407-39606478)
chr1 (306-369)||(40685527-40685590)
chr1 (306-380)||(50248027-50248102)
chr1 (311-369)||(5790061-5790119)
chr1 (307-380)||(35010644-35010718)
chr1 (318-382)||(33845657-33845722)
chr1 (318-382)||(33948256-33948321)
chr1 (305-380)||(15104041-15104117)
chr1 (307-382)||(26261346-26261422)
chr1 (305-376)||(43025883-43025955)
chr1 (305-364)||(19279924-19279983)
chr1 (306-382)||(25083175-25083249)
chr1 (305-364)||(30455201-30455260)
chr1 (310-382)||(39522811-39522884)
chr1 (306-382)||(39787703-39787780)
chr1 (311-375)||(3840423-3840487)
chr1 (307-382)||(27078548-27078623)
chr1 (309-380)||(29511109-29511181)
chr1 (307-382)||(36586250-36586326)
chr1 (310-369)||(18216346-18216405)
chr1 (310-380)||(40962757-40962828)
chr1 (307-380)||(5322591-5322665)
chr1 (310-379)||(8194018-8194088)
chr1 (307-369)||(8214622-8214684)
chr1 (305-366)||(14971622-14971684)
chr1 (382-422)||(6837956-6837996)
chr1 (313-369)||(11797466-11797522)
chr1 (311-382)||(15952885-15952957)
chr1 (309-369)||(22561234-22561294)
chr1 (306-377)||(29510709-29510781)
chr1 (306-362)||(32533825-32533881)
chr1 (311-382)||(39467027-39467099)
chr1 (307-382)||(46850963-46851039)
chr1 (328-382)||(9705547-9705602)
chr1 (313-378)||(10430396-10430463)
chr1 (305-379)||(45007747-45007822)
chr1 (307-380)||(49632553-49632628)
chr1 (307-369)||(46561302-46561364)
chr1 (313-380)||(7204563-7204632)
chr1 (307-356)||(14890286-14890335)
chr1 (310-382)||(21897734-21897807)
chr1 (307-382)||(23225343-23225420)
chr1 (307-364)||(40503596-40503653)
chr1 (330-382)||(47429645-47429698)
chr1 (311-382)||(13048860-13048932)
chr1 (311-382)||(13053857-13053929)
chr1 (311-378)||(32007078-32007145)
chr1 (311-378)||(41808206-41808273)
chr1 (306-369)||(12282613-12282676)
chr1 (306-369)||(23913617-23913680)
chr1 (314-382)||(236575-236645)
chr1 (313-382)||(40241493-40241563)
chr1 (313-351)||(41651078-41651116)
chr1 (313-380)||(17540131-17540200)
chr1 (311-364)||(21938946-21938998)
chr1 (306-382)||(27855995-27856072)
chr1 (334-382)||(29803226-29803275)
chr1 (311-378)||(5055845-5055912)
chr1 (306-382)||(6669305-6669381)
chr1 (307-363)||(11786102-11786158)
chr1 (308-356)||(28381225-28381273)
chr1 (311-378)||(29587256-29587323)
chr1 (311-378)||(29994440-29994507)
chr1 (307-378)||(31278499-31278571)
chr1 (313-353)||(38886472-38886512)
chr1 (313-369)||(43500210-43500266)
chr1 (311-378)||(48660026-48660093)
chr1 (308-378)||(2112747-2112818)
chr1 (306-357)||(15324532-15324583)
chr1 (336-382)||(35758303-35758350)
chr1 (316-378)||(43837095-43837158)
chr1 (311-380)||(50145187-50145258)
chr1 (311-369)||(1576377-1576435)
chr1 (335-369)||(16084300-16084334)
chr1 (313-378)||(25376196-25376262)
chr1 (307-369)||(48302283-48302345)
chr1 (305-382)||(52492734-52492812)
chr1 (382-423)||(8976516-8976557)
chr1 (308-376)||(23809943-23810012)
chr1 (311-356)||(28455878-28455922)
chr1 (307-369)||(36018881-36018939)
chr1 (313-376)||(37186876-37186941)
chr1 (316-357)||(37771077-37771118)
chr1 (313-364)||(16867464-16867516)
chr1 (313-357)||(28689591-28689634)
[»] chr6 (84 HSPs)
chr6 (306-382)||(8448195-8448272)
chr6 (306-382)||(8456999-8457076)
chr6 (305-385)||(17534573-17534654)
chr6 (306-385)||(16496702-16496783)
chr6 (307-382)||(2314652-2314728)
chr6 (305-379)||(31205239-31205314)
chr6 (306-382)||(735443-735520)
chr6 (306-382)||(8939624-8939701)
chr6 (310-378)||(18861824-18861893)
chr6 (305-380)||(1241592-1241668)
chr6 (307-382)||(4083586-4083662)
chr6 (307-382)||(8329611-8329687)
chr6 (307-378)||(10263128-10263200)
chr6 (305-380)||(13507365-13507441)
chr6 (306-382)||(32643781-32643858)
chr6 (305-380)||(4480471-4480547)
chr6 (307-382)||(34287224-34287300)
chr6 (306-369)||(13540228-13540291)
chr6 (310-379)||(16244413-16244483)
chr6 (310-382)||(32107888-32107961)
chr6 (307-382)||(1686287-1686363)
chr6 (307-378)||(5603504-5603576)
chr6 (307-377)||(7098805-7098876)
chr6 (307-369)||(4996871-4996933)
chr6 (307-380)||(29183657-29183731)
chr6 (305-382)||(31747039-31747117)
chr6 (306-382)||(6266630-6266707)
chr6 (310-382)||(12795072-12795145)
chr6 (306-382)||(15953232-15953309)
chr6 (307-379)||(27866587-27866660)
chr6 (306-382)||(28594124-28594201)
chr6 (307-382)||(31444343-31444420)
chr6 (307-378)||(10181044-10181116)
chr6 (307-369)||(4891007-4891069)
chr6 (306-382)||(10330802-10330880)
chr6 (306-379)||(11242653-11242727)
chr6 (310-364)||(21513074-21513128)
chr6 (313-382)||(34830783-34830853)
chr6 (306-382)||(31057830-31057907)
chr6 (311-382)||(2301432-2301504)
chr6 (323-382)||(2959008-2959068)
chr6 (307-378)||(8374141-8374213)
chr6 (307-382)||(10531385-10531461)
chr6 (307-378)||(14982711-14982783)
chr6 (306-380)||(8116801-8116876)
chr6 (307-369)||(7098962-7099024)
chr6 (311-380)||(24571672-24571742)
chr6 (308-365)||(4128945-4129002)
chr6 (307-382)||(8977153-8977230)
chr6 (319-382)||(9949204-9949269)
chr6 (311-378)||(28322936-28323003)
chr6 (305-365)||(30614983-30615043)
chr6 (310-369)||(2395624-2395683)
chr6 (306-380)||(29479427-29479502)
chr6 (311-385)||(34762671-34762746)
chr6 (313-382)||(2746454-2746524)
chr6 (313-382)||(6556536-6556606)
chr6 (311-382)||(1855008-1855081)
chr6 (310-382)||(2236236-2236309)
chr6 (306-382)||(5626113-5626190)
chr6 (310-359)||(8487630-8487679)
chr6 (311-348)||(26269248-26269285)
chr6 (308-379)||(2711304-2711376)
chr6 (307-382)||(6453684-6453760)
chr6 (311-378)||(33621498-33621565)
chr6 (311-378)||(33704220-33704287)
chr6 (336-382)||(5660427-5660474)
chr6 (304-382)||(23383109-23383188)
chr6 (306-380)||(31063001-31063076)
chr6 (319-365)||(8795480-8795526)
chr6 (305-376)||(2018821-2018894)
chr6 (322-382)||(11152531-11152592)
chr6 (308-385)||(11548231-11548308)
chr6 (308-356)||(7974788-7974836)
chr6 (313-379)||(9727499-9727567)
chr6 (313-380)||(17546041-17546109)
chr6 (311-378)||(21000696-21000763)
chr6 (313-368)||(10318955-10319010)
chr6 (340-382)||(35164660-35164703)
chr6 (314-364)||(10673252-10673302)
chr6 (309-369)||(1266809-1266870)
chr6 (313-354)||(31340562-31340603)
chr6 (310-367)||(34182522-34182579)
chr6 (306-358)||(15640515-15640567)
[»] chr7 (122 HSPs)
chr7 (307-382)||(48612516-48612592)
chr7 (305-382)||(35157137-35157215)
chr7 (306-382)||(1573894-1573971)
chr7 (306-378)||(3497574-3497647)
chr7 (306-382)||(4106552-4106629)
chr7 (306-378)||(4887570-4887643)
chr7 (306-382)||(35849293-35849370)
chr7 (307-382)||(19306711-19306787)
chr7 (306-380)||(2354852-2354927)
chr7 (306-380)||(45236928-45237003)
chr7 (305-382)||(4069169-4069247)
chr7 (308-385)||(6384569-6384646)
chr7 (306-382)||(17895632-17895709)
chr7 (306-382)||(47584724-47584801)
chr7 (305-369)||(6596539-6596603)
chr7 (307-382)||(10061069-10061145)
chr7 (307-382)||(31717296-31717372)
chr7 (308-382)||(27396367-27396442)
chr7 (305-382)||(40013260-40013339)
chr7 (306-379)||(9379989-9380063)
chr7 (313-382)||(21226070-21226140)
chr7 (310-382)||(7312506-7312579)
chr7 (311-376)||(10166873-10166938)
chr7 (306-382)||(29151581-29151658)
chr7 (307-382)||(33228698-33228775)
chr7 (307-378)||(1323682-1323754)
chr7 (319-382)||(5508696-5508760)
chr7 (307-378)||(40809044-40809116)
chr7 (307-382)||(45041786-45041862)
chr7 (305-378)||(18944921-18944995)
chr7 (310-382)||(19258426-19258499)
chr7 (305-382)||(40656161-40656241)
chr7 (307-364)||(48729756-48729813)
chr7 (307-382)||(2228133-2228209)
chr7 (307-382)||(6327210-6327286)
chr7 (307-382)||(31300050-31300126)
chr7 (307-378)||(33628027-33628099)
chr7 (307-367)||(46416548-46416608)
chr7 (307-382)||(47182802-47182878)
chr7 (307-380)||(2286148-2286222)
chr7 (317-382)||(16816700-16816766)
chr7 (307-380)||(32251390-32251464)
chr7 (306-382)||(34708671-34708749)
chr7 (307-369)||(42557569-42557631)
chr7 (311-382)||(1869818-1869891)
chr7 (306-378)||(37410759-37410832)
chr7 (310-367)||(38261003-38261060)
chr7 (306-382)||(40857393-40857470)
chr7 (307-382)||(3861389-3861465)
chr7 (325-382)||(1582669-1582727)
chr7 (313-382)||(13769676-13769746)
chr7 (305-382)||(26794909-26794987)
chr7 (305-382)||(29628437-29628515)
chr7 (313-359)||(33512802-33512848)
chr7 (306-368)||(44327638-44327700)
chr7 (310-382)||(4674362-4674435)
chr7 (311-378)||(23789470-23789539)
chr7 (307-382)||(10422477-10422553)
chr7 (310-385)||(12014782-12014858)
chr7 (311-382)||(37919972-37920044)
chr7 (332-382)||(8946452-8946503)
chr7 (306-369)||(37117912-37117975)
chr7 (312-382)||(40873190-40873261)
chr7 (313-382)||(46021484-46021555)
chr7 (307-378)||(48467810-48467881)
chr7 (305-378)||(41780260-41780334)
chr7 (307-379)||(43188528-43188602)
chr7 (305-382)||(45946707-45946785)
chr7 (306-378)||(47086357-47086431)
chr7 (310-382)||(4227336-4227409)
chr7 (311-382)||(43416340-43416413)
chr7 (311-378)||(31770589-31770656)
chr7 (305-349)||(36280012-36280056)
chr7 (307-382)||(41862786-41862862)
chr7 (307-382)||(43723311-43723387)
chr7 (307-367)||(47459415-47459475)
chr7 (305-352)||(788930-788977)
chr7 (318-369)||(10084366-10084417)
chr7 (310-369)||(19563162-19563221)
chr7 (306-379)||(5222629-5222703)
chr7 (308-382)||(9234300-9234377)
chr7 (316-354)||(10703973-10704011)
chr7 (306-382)||(46274945-46275023)
chr7 (318-378)||(14817437-14817498)
chr7 (318-378)||(15264433-15264494)
chr7 (306-367)||(20350260-20350321)
chr7 (313-378)||(26336437-26336502)
chr7 (313-364)||(6369533-6369584)
chr7 (313-364)||(6377998-6378049)
chr7 (307-358)||(23138648-23138699)
chr7 (313-382)||(43133156-43133227)
chr7 (311-377)||(47250309-47250375)
chr7 (307-353)||(5110835-5110881)
chr7 (307-369)||(5523792-5523854)
chr7 (310-364)||(24382593-24382647)
chr7 (311-369)||(38678230-38678288)
chr7 (307-375)||(7264404-7264473)
chr7 (307-379)||(22752890-22752963)
chr7 (308-369)||(28234926-28234987)
chr7 (323-364)||(28382604-28382645)
chr7 (313-365)||(35196879-35196932)
chr7 (311-378)||(990218-990286)
chr7 (311-378)||(4106742-4106809)
chr7 (330-377)||(10092696-10092744)
chr7 (305-379)||(46715746-46715822)
chr7 (310-380)||(3043871-3043942)
chr7 (313-356)||(7162868-7162910)
chr7 (323-366)||(31807117-31807160)
chr7 (308-378)||(43753811-43753881)
chr7 (313-379)||(45350625-45350692)
chr7 (325-378)||(9932235-9932289)
chr7 (306-382)||(30627621-30627699)
chr7 (301-358)||(46034303-46034361)
chr7 (311-356)||(2146640-2146684)
chr7 (311-375)||(25546335-25546399)
chr7 (311-364)||(28649438-28649491)
chr7 (307-352)||(38930362-38930407)
chr7 (313-380)||(46734171-46734240)
chr7 (339-378)||(8856308-8856348)
chr7 (311-378)||(25112304-25112371)
chr7 (313-356)||(38504603-38504647)
chr7 (311-378)||(43203310-43203377)
[»] chr5 (142 HSPs)
chr5 (307-382)||(6672240-6672316)
chr5 (307-382)||(17869177-17869253)
chr5 (307-382)||(18473913-18473989)
chr5 (307-382)||(23311226-23311302)
chr5 (307-382)||(36569278-36569354)
chr5 (305-382)||(25328357-25328435)
chr5 (306-382)||(2103024-2103101)
chr5 (306-382)||(4164957-4165034)
chr5 (306-385)||(21728658-21728739)
chr5 (306-382)||(28143285-28143362)
chr5 (306-382)||(42448209-42448286)
chr5 (307-378)||(1244238-1244310)
chr5 (306-382)||(36726987-36727062)
chr5 (307-382)||(41562457-41562533)
chr5 (307-380)||(9054026-9054100)
chr5 (307-382)||(23074697-23074774)
chr5 (310-378)||(29119608-29119677)
chr5 (306-382)||(39150979-39151056)
chr5 (306-382)||(42068539-42068616)
chr5 (307-382)||(4617819-4617895)
chr5 (307-382)||(16496599-16496675)
chr5 (305-382)||(24652367-24652445)
chr5 (309-382)||(38682929-38683003)
chr5 (310-382)||(9902554-9902627)
chr5 (307-382)||(1650290-1650366)
chr5 (319-382)||(34930236-34930300)
chr5 (307-382)||(36136915-36136991)
chr5 (306-380)||(12878173-12878248)
chr5 (306-380)||(37067699-37067774)
chr5 (305-382)||(1269572-1269650)
chr5 (306-379)||(11968774-11968848)
chr5 (307-365)||(22620722-22620780)
chr5 (311-380)||(37940921-37940991)
chr5 (310-382)||(10393555-10393628)
chr5 (306-382)||(12665093-12665170)
chr5 (307-379)||(12707932-12708005)
chr5 (306-382)||(23310398-23310475)
chr5 (306-382)||(29806565-29806642)
chr5 (306-378)||(39143439-39143512)
chr5 (310-382)||(39527934-39528007)
chr5 (307-382)||(1287314-1287390)
chr5 (307-382)||(6041897-6041973)
chr5 (311-382)||(6053104-6053176)
chr5 (311-382)||(10154215-10154287)
chr5 (307-382)||(14107251-14107327)
chr5 (319-382)||(16906348-16906412)
chr5 (307-382)||(26267054-26267130)
chr5 (307-382)||(34675746-34675822)
chr5 (307-382)||(36319555-36319631)
chr5 (306-380)||(671114-671189)
chr5 (307-380)||(1833374-1833449)
chr5 (307-380)||(40318840-40318915)
chr5 (307-369)||(7179368-7179430)
chr5 (325-382)||(36854211-36854269)
chr5 (313-382)||(40595962-40596031)
chr5 (306-382)||(9068801-9068878)
chr5 (306-382)||(14808833-14808910)
chr5 (322-382)||(27389980-27390041)
chr5 (306-382)||(33028228-33028305)
chr5 (314-382)||(37191250-37191319)
chr5 (307-375)||(40044976-40045045)
chr5 (305-369)||(4444915-4444978)
chr5 (307-382)||(6029611-6029687)
chr5 (307-382)||(10165531-10165607)
chr5 (304-379)||(18625671-18625747)
chr5 (307-378)||(24051402-24051474)
chr5 (307-382)||(24443920-24443996)
chr5 (307-382)||(26802333-26802409)
chr5 (307-382)||(26809883-26809959)
chr5 (307-382)||(26824910-26824986)
chr5 (307-382)||(33617095-33617171)
chr5 (320-382)||(34856592-34856656)
chr5 (305-382)||(36790368-36790447)
chr5 (307-380)||(41408625-41408700)
chr5 (313-382)||(43070737-43070807)
chr5 (307-379)||(12769181-12769254)
chr5 (307-382)||(9640587-9640663)
chr5 (305-369)||(19836154-19836218)
chr5 (303-382)||(23219173-23219253)
chr5 (305-380)||(32466566-32466642)
chr5 (311-382)||(43150211-43150283)
chr5 (307-380)||(5203549-5203624)
chr5 (310-365)||(10070758-10070813)
chr5 (299-354)||(37142108-37142163)
chr5 (307-358)||(42337921-42337972)
chr5 (313-382)||(16371525-16371595)
chr5 (317-382)||(32274029-32274095)
chr5 (307-382)||(1277436-1277513)
chr5 (306-382)||(10011468-10011545)
chr5 (310-382)||(10458728-10458801)
chr5 (313-381)||(27004019-27004088)
chr5 (306-382)||(36185135-36185212)
chr5 (310-382)||(36246047-36246119)
chr5 (306-380)||(25567737-25567813)
chr5 (318-369)||(4430008-4430059)
chr5 (306-369)||(8487395-8487458)
chr5 (313-367)||(8595556-8595611)
chr5 (318-380)||(41071072-41071135)
chr5 (305-382)||(4228854-4228932)
chr5 (320-381)||(5276358-5276420)
chr5 (311-365)||(34174323-34174377)
chr5 (311-382)||(972647-972720)
chr5 (307-382)||(15067193-15067270)
chr5 (302-382)||(17080459-17080540)
chr5 (305-362)||(19090431-19090488)
chr5 (306-378)||(28391171-28391244)
chr5 (311-378)||(6219247-6219315)
chr5 (307-382)||(29293575-29293651)
chr5 (311-382)||(40199157-40199229)
chr5 (307-377)||(1931147-1931218)
chr5 (306-364)||(2706202-2706260)
chr5 (322-379)||(20695539-20695597)
chr5 (313-351)||(29069633-29069671)
chr5 (308-380)||(12638523-12638596)
chr5 (306-380)||(13550303-13550379)
chr5 (308-380)||(18692506-18692579)
chr5 (313-380)||(22792165-22792234)
chr5 (340-380)||(29622237-29622278)
chr5 (306-358)||(7153266-7153318)
chr5 (307-382)||(7670365-7670441)
chr5 (311-378)||(13203961-13204028)
chr5 (307-382)||(18115092-18115168)
chr5 (307-382)||(31895565-31895640)
chr5 (317-369)||(42653550-42653602)
chr5 (312-382)||(2025734-2025805)
chr5 (306-380)||(13549206-13549281)
chr5 (313-379)||(22963693-22963760)
chr5 (313-382)||(26526517-26526588)
chr5 (306-364)||(28489180-28489239)
chr5 (332-382)||(36259821-36259872)
chr5 (311-353)||(12257360-12257401)
chr5 (310-356)||(21067439-21067485)
chr5 (305-382)||(24637951-24638029)
chr5 (311-356)||(4825019-4825063)
chr5 (318-382)||(9362541-9362606)
chr5 (310-351)||(12819630-12819671)
chr5 (311-378)||(1191597-1191664)
chr5 (308-356)||(8733997-8734044)
chr5 (311-378)||(9577018-9577085)
chr5 (313-356)||(30527986-30528030)
chr5 (313-356)||(30568326-30568370)
chr5 (306-358)||(42559907-42559959)
[»] chr4 (140 HSPs)
chr4 (306-385)||(3848868-3848948)
chr4 (307-382)||(12821164-12821240)
chr4 (307-382)||(49882762-49882838)
chr4 (304-382)||(35828270-35828349)
chr4 (306-382)||(7512765-7512842)
chr4 (306-382)||(47462089-47462166)
chr4 (307-382)||(5396993-5397069)
chr4 (307-382)||(30044637-30044713)
chr4 (307-382)||(42154191-42154267)
chr4 (306-379)||(49535883-49535957)
chr4 (306-378)||(9569473-9569546)
chr4 (306-382)||(46488170-46488247)
chr4 (306-382)||(50779844-50779921)
chr4 (311-378)||(1033506-1033574)
chr4 (307-382)||(14285094-14285170)
chr4 (307-382)||(24712087-24712163)
chr4 (303-382)||(42412041-42412121)
chr4 (310-380)||(37050703-37050774)
chr4 (307-369)||(42856562-42856624)
chr4 (306-382)||(29428053-29428130)
chr4 (307-382)||(13389019-13389095)
chr4 (311-382)||(18813373-18813445)
chr4 (307-378)||(23974699-23974771)
chr4 (307-382)||(24550812-24550888)
chr4 (307-382)||(31263554-31263630)
chr4 (307-382)||(34684202-34684277)
chr4 (311-382)||(54907945-54908017)
chr4 (306-369)||(1982559-1982622)
chr4 (306-379)||(13632087-13632162)
chr4 (313-379)||(28033197-28033264)
chr4 (312-382)||(37166142-37166213)
chr4 (307-369)||(3084309-3084371)
chr4 (307-380)||(4379306-4379380)
chr4 (313-382)||(24407502-24407572)
chr4 (319-380)||(51281477-51281539)
chr4 (306-378)||(49319729-49319802)
chr4 (307-382)||(28010104-28010180)
chr4 (307-378)||(29648763-29648835)
chr4 (307-382)||(36526194-36526270)
chr4 (310-380)||(5880341-5880412)
chr4 (306-369)||(12694521-12694584)
chr4 (310-380)||(52556438-52556509)
chr4 (307-369)||(35318539-35318601)
chr4 (316-381)||(51564445-51564511)
chr4 (318-382)||(25586380-25586445)
chr4 (306-382)||(28983730-28983807)
chr4 (313-380)||(11673298-11673366)
chr4 (307-378)||(29894409-29894481)
chr4 (307-382)||(31375112-31375188)
chr4 (306-380)||(1083506-1083581)
chr4 (307-378)||(10757945-10758016)
chr4 (307-378)||(10971116-10971187)
chr4 (310-369)||(32104077-32104136)
chr4 (306-380)||(36752357-36752432)
chr4 (316-382)||(39284628-39284694)
chr4 (307-382)||(6487848-6487921)
chr4 (305-378)||(39301327-39301401)
chr4 (306-378)||(26440965-26441038)
chr4 (306-382)||(31435971-31436048)
chr4 (310-378)||(33416637-33416706)
chr4 (307-382)||(42116480-42116556)
chr4 (307-381)||(3037236-3037311)
chr4 (307-380)||(12315985-12316059)
chr4 (307-369)||(17518540-17518602)
chr4 (307-376)||(25698999-25699069)
chr4 (307-369)||(44171648-44171710)
chr4 (310-364)||(51425332-51425386)
chr4 (306-382)||(39997826-39997903)
chr4 (311-382)||(579295-579367)
chr4 (319-378)||(1052940-1053000)
chr4 (311-382)||(18371349-18371421)
chr4 (307-366)||(55853384-55853444)
chr4 (308-379)||(17815199-17815270)
chr4 (313-382)||(24870601-24870672)
chr4 (316-382)||(29334503-29334570)
chr4 (324-382)||(34660844-34660903)
chr4 (313-378)||(46343333-46343400)
chr4 (310-382)||(8810822-8810896)
chr4 (310-368)||(9038274-9038332)
chr4 (332-382)||(11311580-11311630)
chr4 (313-382)||(17271304-17271374)
chr4 (311-369)||(28187231-28187289)
chr4 (307-364)||(35273378-35273436)
chr4 (313-382)||(46194254-46194324)
chr4 (316-382)||(55214484-55214550)
chr4 (306-382)||(9064842-9064919)
chr4 (307-378)||(9749139-9749212)
chr4 (306-382)||(11371113-11371190)
chr4 (307-382)||(17480930-17481007)
chr4 (382-423)||(28390978-28391019)
chr4 (307-379)||(54086010-54086083)
chr4 (311-378)||(1173955-1174022)
chr4 (305-380)||(5060465-5060541)
chr4 (311-378)||(19225263-19225330)
chr4 (307-382)||(21172878-21172954)
chr4 (311-378)||(34739284-34739351)
chr4 (332-380)||(43588790-43588838)
chr4 (319-382)||(47384209-47384273)
chr4 (311-378)||(54768489-54768556)
chr4 (310-369)||(4901924-4901983)
chr4 (336-382)||(7944277-7944324)
chr4 (304-382)||(17846803-17846882)
chr4 (306-382)||(21378293-21378363)
chr4 (332-382)||(46552949-46553000)
chr4 (310-369)||(54864398-54864457)
chr4 (308-369)||(21156022-21156084)
chr4 (308-380)||(33840619-33840693)
chr4 (316-382)||(38882724-38882793)
chr4 (313-382)||(48628517-48628587)
chr4 (307-379)||(12619239-12619312)
chr4 (307-352)||(31010029-31010074)
chr4 (306-382)||(51675720-51675797)
chr4 (306-382)||(52303149-52303226)
chr4 (311-378)||(238515-238582)
chr4 (311-374)||(18257333-18257396)
chr4 (311-378)||(19849560-19849627)
chr4 (311-378)||(43139963-43140030)
chr4 (306-358)||(50501403-50501455)
chr4 (311-382)||(54096993-54097065)
chr4 (322-369)||(35615899-35615946)
chr4 (306-376)||(53398347-53398418)
chr4 (306-382)||(2573927-2574005)
chr4 (311-369)||(8017853-8017911)
chr4 (310-379)||(13218199-13218269)
chr4 (307-369)||(25726594-25726656)
chr4 (311-356)||(11277986-11278030)
chr4 (316-379)||(28758384-28758449)
chr4 (319-382)||(36860902-36860967)
chr4 (307-364)||(49870081-49870138)
chr4 (311-375)||(53457828-53457892)
chr4 (333-380)||(16971737-16971785)
chr4 (311-378)||(26424915-26424981)
chr4 (311-378)||(28798445-28798512)
chr4 (310-357)||(32233613-32233661)
chr4 (313-353)||(32662685-32662725)
chr4 (307-351)||(34123408-34123452)
chr4 (313-345)||(37913318-37913350)
chr4 (306-380)||(38814580-38814656)
chr4 (341-369)||(42550490-42550518)
chr4 (323-359)||(54420238-54420274)
[»] scaffold0287 (1 HSPs)
scaffold0287 (306-378)||(1115-1188)
[»] scaffold0778 (1 HSPs)
scaffold0778 (302-385)||(812-896)
[»] scaffold0179 (1 HSPs)
scaffold0179 (306-385)||(4065-4145)
[»] scaffold0008 (1 HSPs)
scaffold0008 (307-382)||(39366-39442)
[»] scaffold0024 (1 HSPs)
scaffold0024 (306-385)||(160445-160526)
[»] scaffold0595 (1 HSPs)
scaffold0595 (307-382)||(344-420)
[»] scaffold0061 (1 HSPs)
scaffold0061 (307-382)||(8912-8988)
[»] scaffold0013 (1 HSPs)
scaffold0013 (306-382)||(90567-90644)
[»] scaffold0457 (1 HSPs)
scaffold0457 (311-382)||(6782-6854)
[»] scaffold0515 (1 HSPs)
scaffold0515 (306-382)||(2476-2553)
[»] scaffold0306 (1 HSPs)
scaffold0306 (306-382)||(2476-2553)
[»] scaffold0122 (2 HSPs)
scaffold0122 (311-368)||(15664-15721)
scaffold0122 (311-369)||(18058-18116)
[»] scaffold0163 (2 HSPs)
scaffold0163 (305-365)||(26988-27048)
scaffold0163 (313-369)||(5539-5595)
[»] scaffold0882 (1 HSPs)
scaffold0882 (312-378)||(3754-3821)
[»] scaffold0244 (1 HSPs)
scaffold0244 (307-380)||(7812-7886)
[»] scaffold0041 (1 HSPs)
scaffold0041 (312-382)||(93021-93092)
[»] scaffold0057 (1 HSPs)
scaffold0057 (306-379)||(64281-64355)
[»] scaffold0036 (1 HSPs)
scaffold0036 (313-363)||(95154-95204)
[»] scaffold0242 (2 HSPs)
scaffold0242 (310-377)||(15060-15128)
scaffold0242 (310-377)||(23895-23963)
[»] scaffold0038 (1 HSPs)
scaffold0038 (311-378)||(114256-114323)
[»] scaffold0548 (1 HSPs)
scaffold0548 (332-382)||(6772-6822)
[»] scaffold0014 (1 HSPs)
scaffold0014 (307-382)||(195739-195816)
[»] scaffold0002 (1 HSPs)
scaffold0002 (307-379)||(411647-411720)
[»] scaffold1348 (1 HSPs)
scaffold1348 (311-378)||(919-986)
[»] scaffold0633 (1 HSPs)
scaffold0633 (313-351)||(3880-3918)
[»] scaffold0098 (1 HSPs)
scaffold0098 (319-369)||(4682-4732)
[»] scaffold0070 (1 HSPs)
scaffold0070 (329-382)||(42073-42127)
[»] scaffold0364 (1 HSPs)
scaffold0364 (310-367)||(11980-12037)
[»] scaffold0067 (1 HSPs)
scaffold0067 (308-356)||(34819-34866)
[»] scaffold0795 (1 HSPs)
scaffold0795 (320-358)||(1072-1110)
[»] scaffold0684 (1 HSPs)
scaffold0684 (305-367)||(2158-2220)
[»] scaffold0044 (1 HSPs)
scaffold0044 (311-356)||(10053-10097)


Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 143)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 29 - 306
Target Start/End: Original strand, 43347920 - 43348197
Alignment:
Q  29 caaagattacaaaagattcaacggacacatccctcatgaatgcttcaaaacacaattctaatcctaaattctagttctaattctaatctaagcatttgcc 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43347920 caaagattacaaaagattcaacggacacatccctcatgaatgcttcaaaacacaattctaatcctaaattctagttctaattctaatctaagcatttgcc 43348019  T
Q  129 ataaatagccatttctttgcaatttgtcacagtcttggtgatttactgatttcattcttgtattgaattgaatcaaattactattatcttataataaatg 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43348020 ataaatagccatttctttgcaatttgtcacagtcttggtgatttactgatttcattcttgtattgaattgaatcaaattactattatcttataataaatg 43348119  T
Q  229 aaatgataataaatttccatgaacacgatgctaattgtacacttctatcatattactcaactaaatactcattcacat 306  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  43348120 aaatgataataaatttccatgaacacgatgctagttgtacacttctatcatattactcaactaaatactcattcacat 43348197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 2733615 - 2733691
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  2733615 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 2733691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 305 - 385
Target Start/End: Original strand, 3054021 - 3054101
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggtgcc 385  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||    
T  3054021 atatccagaagttctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactgggttcgaaacccggtgcc 3054101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 14188087 - 14188165
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  14188087 atatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgacctgggttcgaaccccggt 14188165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 25250783 - 25250860
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||    
T  25250783 tatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggt 25250860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 36586480 - 36586557
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||    
T  36586480 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggt 36586557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 37295128 - 37295201
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  37295128 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 37295201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 4430864 - 4430788
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  4430864 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 4430788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6317299 - 6317375
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  6317299 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 6317375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 19649627 - 19649551
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  19649627 atccagaagtcatagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 19649551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 27928157 - 27928233
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||    
T  27928157 atccagaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgaccggggttcgaaccccggt 27928233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 34711684 - 34711608
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||    
T  34711684 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggt 34711608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 25199043 - 25199121
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||    
T  25199043 atatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgctatgaccgggtttcgaaccccggt 25199121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 38070612 - 38070534
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||    
T  38070612 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgacatgaccgggattcgaaccacggt 38070534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 4977164 - 4977087
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||| ||||||||||||||||    
T  4977164 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggaccccatgaccggggttcgaaccccggt 4977087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 26690696 - 26690765
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  26690696 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc 26690765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 38953610 - 38953533
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  38953610 tatccagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 38953533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 11100417 - 11100341
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||    
T  11100417 atccagaagtcctagctcaactggaaaaatgccgaaattgttaggccggatgccatgatcggagttcgaaccccggt 11100341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 24654973 - 24655049
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  ||||||||||||||||    
T  24654973 atccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggt 24655049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 310 - 385
Target Start/End: Original strand, 25213631 - 25213707
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggtgcc 385  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||    
T  25213631 cagaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccccggtgcc 25213707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 26737970 - 26738046
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  26737970 atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 26738046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 43820867 - 43820943
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  43820867 atccagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 43820943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 44814866 - 44814938
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  44814866 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 44814938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 312 - 382
Target Start/End: Original strand, 9569728 - 9569799
Alignment:
Q  312 gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  9569728 gaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 9569799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 309 - 382
Target Start/End: Complemental strand, 6845110 - 6845036
Alignment:
Q  309 ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||    
T  6845110 ccagaagtcctagctcaattggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggt 6845036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 7772181 - 7772103
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| | ||||||||||||||||    
T  7772181 atatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt 7772103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 10096615 - 10096685
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||    
T  10096615 agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccg 10096685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2442760 - 2442837
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||    
T  2442760 tatccataagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcaaaccccggt 2442837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 25063338 - 25063415
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  25063338 atccagaagtcctagttcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 25063415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 25893853 - 25893926
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||    
T  25893853 cagaagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgatcggggttcgaaccccggt 25893926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 31639232 - 31639155
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |||||    
T  31639232 tatccagaagtcctaactcaactagcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggt 31639155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 33067518 - 33067441
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||    
T  33067518 tatccggaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaactccggt 33067441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 37708577 - 37708500
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||||||||||||    
T  37708577 tatccataagtcctagctcaactggcaaaatgccgaaattgttaggacggatgctatgaccggggttcgaaccccggt 37708500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 4312132 - 4312208
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||  |||||||||| |||||    
T  4312132 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgactggggttcgaactccggt 4312208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 17649970 - 17649895
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    |||||||| ||||||||||||||||||||| |||||||||||| |||||||| ||||| |||||||||||||||||    
T  17649970 atccagaaatcctagctcaactggcaaaataccgaaattgttaagccggatgtcatgatcgggttcgaaccccggt 17649895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 37817374 - 37817449
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||    
T  37817374 tatccataagtcctagctcaactggcaaaatgacgaaattgttaggtcggatgccatgaccggggttcgaaccccg 37817449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 8569943 - 8570020
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||  |||||||||||||||||||||| |||||  ||||||||||||||||    
T  8569943 tatccagaagtcctagctcaactggcaaaagaccgaaattgttaggccggatgcaatgactggggttcgaaccccggt 8570020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 9998773 - 9998696
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| ||||||||||| |||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||||||    
T  9998773 tatctagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccccggt 9998696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 23681012 - 23681085
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||    
T  23681012 cagaagtcctaactcaactggcaaaatgccaaaattattaggccggatgccatgaccggggttcgaaccccggt 23681085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 24242715 - 24242638
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  24242715 atccagaagtcctaactcaaccggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 24242638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 35421747 - 35421674
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    ||||||||||||||| ||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||    
T  35421747 atccagaagtcctagttcaactggcaaaatgtcgaaattgttaggccgaatgccatgaccggggttcgaacccc 35421674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 40744371 - 40744299
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||| ||||||||||    
T  40744371 atccagaagtcctagctcaactggcaaaatgtcaaaattgttaggccagatgccatgaccggagttcgaaccc 40744299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 41562441 - 41562517
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||| | ||||||||||||||||    
T  41562441 atccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggt 41562517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 308 - 382
Target Start/End: Original strand, 403666 - 403741
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| |||||||||||||||||  |||||||||||||||||||| |||||||||||||| ||||||||||||||||    
T  403666 tccacaagtcctagctcaactgataaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggt 403741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 34143484 - 34143421
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||    
T  34143484 tatccagaagtcctaactcaattagcaaaatgccgaaattgttaggccggatgccatgaccggg 34143421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 34540190 - 34540131
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
T  34540190 cagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatgccatgatcggg 34540131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 35810235 - 35810298
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||| ||||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35810235 tatccacaagttatagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 35810298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 376
Target Start/End: Complemental strand, 8547259 - 8547189
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaac 376  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||| ||||||||    
T  8547259 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcataaccggagttcgaac 8547189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 20990543 - 20990469
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    ||||||||||| |||||||||||||||||||||||| ||||||||| |||||| ||||||| |||||||||||||    
T  20990543 tatccagaagttctagctcaactggcaaaatgccgacattgttaggtcggatgtcatgaccagggttcgaacccc 20990469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 34744397 - 34744319
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||| || |||||||||| ||||    
T  34744397 atatccagaagtcatagctcaactggcaaaatgccgatattgttagggcggatgccatgatcgtggttcgaacctcggt 34744319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 44604944 - 44604874
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||| |||||||||||||||||||||||| |||||||||||| | ||||||||||||||||    
T  44604944 aagtcctagctcaattggcaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggt 44604874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 14243701 - 14243774
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||||||||||||||||| ||||||||||||||||||||| | ||| |||||||| |||||||||||||||    
T  14243701 cagaagtcctagctcaactggtaaaatgccgaaattgttaggctgaatgtcatgaccgaggttcgaaccccggt 14243774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 26226841 - 26226765
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||||||||| |||||| |||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||    
T  26226841 tatccagaagtccaagctcagctgg-aaaatgctgaaattgttaggccggatgccatgaccgaggttcgaaccccggt 26226765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 5704757 - 5704681
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||| ||||||| ||||||||||||||| |||||||||||| ||||| ||||||||||    
T  5704757 atccacaagtcctagctcaactgacaaaatgtcgaaattgttaggccagatgccatgaccggggtttgaaccccggt 5704681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 5895924 - 5895848
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||||||||||| |||||||||||||||| |||| |||| | ||||||||||||||||    
T  5895924 atccataagtcctagctcaactggcaaaatgtcgaaattgttaggccgaatgctatgatcggggttcgaaccccggt 5895848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 10617788 - 10617860
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||  ||||||||||||||||    
T  10617788 agaagtcctagctcaactgacaaaatgccgacattgttaggccggatgtcatgactggggttcgaaccccggt 10617860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 16395372 - 16395448
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||| ||||||||| ||||||| |||||||||||||||||| | |||||| ||||||||||||||||    
T  16395372 atccagaagtcctaactcaactggtaaaatgctgaaattgttaggccggatactatgaccggggttcgaaccccggt 16395448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 4694817 - 4694754
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||| ||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||    
T  4694817 tatccataagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggg 4694754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 26675559 - 26675618
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||  ||||||||||    
T  26675559 cagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatatcatgaccggg 26675618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 313 - 379
Target Start/End: Complemental strand, 32922997 - 32922930
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||| ||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||    
T  32922997 aagtcctaactcaattggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaacccc 32922930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 365
Target Start/End: Complemental strand, 39667021 - 39666966
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
T  39667021 cagaagtcctaactcaactgacaaaatgccgaaattgttaggccggatgccatgac 39666966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 18040133 - 18040211
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||  ||||||| ||||||||||||||||||| ||||| || | |||||||||||||    
T  18040133 atatccagaagtcctagctcaactgataaaatgctgaaattgttaggccggatgtcatgacccagattcgaaccccggt 18040211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 368
Target Start/End: Original strand, 20150219 - 20150281
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg 368  Q
    ||||||||| |||||||||||||||||||||| | |||||||||||||||||| |||||||||    
T  20150219 tatccagaattcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgaccgg 20150281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 16501651 - 16501724
Alignment:
Q  311 agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||| || |||||||||| ||||||||||||| ||||||||||||||||    
T  16501651 agaagtcctagctcaactggcaaaaatgctgatattgttaggctggatgccatgaccggggttcgaaccccggt 16501724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 27545046 - 27544969
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||||||||||| ||||||||||||| ||||||  ||| || ||||||||||||||||    
T  27545046 tatccagaagttctagctcaactggcaaaatgtcgaaattgttaggtcggatgttatgtccggggttcgaaccccggt 27544969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 27849872 - 27849796
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  27849872 atccagaagtcctaactcaactgacaaaaatgccgaaattgttaggccggatg-catgaccggggttcgaaccccggt 27849796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 308 - 369
Target Start/End: Complemental strand, 41746776 - 41746715
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||| ||||    
T  41746776 tccagaagtcctagctcaactgacaaaatgccaaaattattaggccggatgccatgatcggg 41746715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 306 - 377
Target Start/End: Original strand, 15129635 - 15129707
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacc 377  Q
    |||||||||||||||||||||| ||||||||||| ||||||||||| | |||||||||| || ||||||||||    
T  15129635 tatccagaagtcctagctcaaccggcaaaatgccaaaattgttaggtctgatgccatgatcgaggttcgaacc 15129707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 21530779 - 21530855
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||| || ||||||||||| ||||||| |||||||||||||| ||||||||||||||| |||||||| ||||||    
T  21530779 atccagatgttctagctcaactagcaaaataccgaaattgttaggtcggatgccatgaccgaggttcgaatcccggt 21530855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 35222272 - 35222348
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||| || ||||||||||||||| |||||| ||||||||||||| ||||| ||||||||| |||||||||||||||    
T  35222272 atccacaaatcctagctcaactggtaaaatgtcgaaattgttaggtcggataccatgaccgaggttcgaaccccggt 35222348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 313 - 379
Target Start/End: Complemental strand, 5700771 - 5700705
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||| ||||||||||||| |||||||||||||||||||||||| |||||| |||||||||||||    
T  5700771 aagtcctaactcaactggcaaa-tgccgaaattgttaggccggatgctatgaccggggttcgaacccc 5700705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 6436707 - 6436758
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  6436707 aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 6436758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 2589285 - 2589363
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||| || || |||||||||||| |||||||| |||||||||||| | |||||||||||||| ||||||||||||||    
T  2589285 atatccggatgttctagctcaactgacaaaatgctgaaattgttaggtcagatgccatgaccggagttcgaaccccggt 2589363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 13634845 - 13634907
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||| ||||||||||||||||||||||||||||||||| | |||| ||||| ||||    
T  13634845 atccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcagatgtcatgatcggg 13634907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 13735258 - 13735320
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||| ||||||||||||||||||||||||||||||||| | |||| ||||| ||||    
T  13735258 atccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcagatgtcatgatcggg 13735320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 20662521 - 20662583
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||| |||||| |  ||||||| ||||||||||||||||||||||||||||||    
T  20662521 atccagaagtcctacctcaaccgctaaaatgctgaaattgttaggccggatgccatgaccggg 20662583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 319 - 380
Target Start/End: Complemental strand, 36372140 - 36372078
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg 380  Q
    |||||||||||||||||||||||||||||||||||||||  ||||||  ||||||||||||||    
T  36372140 tagctcaactggcaaaatgccgaaattgttaggccggatatcatgactggggttcgaaccccg 36372078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 319 - 380
Target Start/End: Original strand, 40999764 - 40999826
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg 380  Q
    |||||||||||  |||||| ||||||||||||||||||||||||||||||| |||||||||||    
T  40999764 tagctcaactgataaaatgtcgaaattgttaggccggatgccatgaccgggattcgaaccccg 40999826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2527200 - 2527277
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||||||| |||||||||||||||||| || ||||||||| |||||||||||| ||  ||||||||| ||||||    
T  2527200 tatccagaagtcttagctcaactggcaaaatcccaaaattgttaagccggatgccataactggggttcgaatcccggt 2527277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 24242028 - 24241951
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||||||| |||||||||||| ||||||| ||||||||||||  ||||||||||| ||| |||||||| |||||    
T  24242028 tatccagaagtcatagctcaactggtaaaatgcagaaattgttaggttggatgccatgatcggagttcgaactccggt 24241951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 382 - 423
Target Start/End: Complemental strand, 32526623 - 32526582
Alignment:
Q  382 tgccatctccttggatttcaattgcagcaaaccttgatgatg 423  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  32526623 tgccatctccttggatttcaattgcagcaaaccttgatgatg 32526582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 40344488 - 40344560
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatg-accgggttcgaaccc 378  Q
    |||||||||||||||| ||||||| ||||||||||||||||||| |||||||| |||| || ||||||||||||    
T  40344488 tatccagaagtcctagttcaactgtcaaaatgccgaaattgtta-gccggatgtcatgaacggggttcgaaccc 40344560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 29158797 - 29158873
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||| ||||| |||||||| |||| | |||||||||||||||||||| |||||| | ||||||||||||||||    
T  29158797 atccagaaatcctaactcaactgacaaagtaccgaaattgttaggccggataccatgatcggggttcgaaccccggt 29158873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 313 - 380
Target Start/End: Original strand, 37953788 - 37953856
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg 380  Q
    |||||||||||||||||| |||||| ||||||||||||||||||||| ||||  | |||||||||||||    
T  37953788 aagtcctagctcaactggaaaaatgtcgaaattgttaggccggatgctatgattgtggttcgaaccccg 37953856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 38017303 - 38017227
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||| ||||| |||||||||||| |||||||||||||| ||| |||||||| ||||||  ||||||||||||||||    
T  38017303 atccaaaagtcatagctcaactggaaaaatgccgaaattattaagccggatgtcatgacgggggttcgaaccccggt 38017227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 2508264 - 2508201
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||| |||||||  ||||||||| ||||||||||| |||||| ||||||||||    
T  2508264 tatccagaagtcctaactcaactaacaaaatgccaaaattgttaggacggatgtcatgaccggg 2508201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 11564996 - 11565075
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||| |||| ||||| |||||||||||||| ||| |||||||||||||||||||| |||||||| |||||||| |||||    
T  11564996 atatctagaaatcctaactcaactggcaaaaatgctgaaattgttaggccggatgctatgaccggagttcgaactccggt 11565075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 314 - 369
Target Start/End: Complemental strand, 34642559 - 34642504
Alignment:
Q  314 agtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||| || ||||||||||||||||||||||||||| |||||| ||||||||||    
T  34642559 agtcctacctgaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggg 34642504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 321 - 382
Target Start/End: Complemental strand, 8525316 - 8525254
Alignment:
Q  321 gctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||| ||||||||||| |||||||| ||||||||||||||  ||||||||||||||||    
T  8525316 gctcaactgacaaaatgccgacattgttagaccggatgccatgactggggttcgaaccccggt 8525254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 38216884 - 38216822
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||| ||| |||||||  |||||||||||||||||||||| |||| ||||||||||    
T  38216884 atccagaagtcttagttcaactgaaaaaatgccgaaattgttaggccagatgtcatgaccggg 38216822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 41278604 - 41278674
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||| |||||||||||||||||| || |||||||||||| |||||| ||||| || ||||||||||||    
T  41278604 agaagtcttagctcaactggcaaaataccaaaattgttaggctggatgctatgactggagttcgaaccccg 41278674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 360
Target Start/End: Complemental strand, 11265185 - 11265132
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgcc 360  Q
    ||||||||||||||| ||||||| ||||||| | ||||||||||||||||||||    
T  11265185 atccagaagtcctagttcaactgacaaaatgtcaaaattgttaggccggatgcc 11265132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 379
Target Start/End: Complemental strand, 12702423 - 12702354
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacccc 379  Q
    ||||||||||||||||||||  |||| ||||||||||||||||||| ||| |||| | ||||||||||||    
T  12702423 agaagtcctagctcaactggttaaataccgaaattgttaggccggacgccttgacggaggttcgaacccc 12702354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 22762003 - 22762060
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||| |||| ||||||| ||||||||||||||||||||| |||||| |||||    
T  22762003 atccagaagttctagttcaactgacaaaatgccgaaattgttaggtcggatgtcatga 22762060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 27817555 - 27817502
Alignment:
Q  330 gcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||    
T  27817555 gcaaaatgccgaaattgttagaccggatgtcatgaccggggttcgaaccccggt 27817502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 42650167 - 42650224
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    ||||| |||||||| |||||| || |||||||||||||||||||| ||||||||||||    
T  42650167 atccacaagtcctaactcaaccggtaaaatgccgaaattgttaggtcggatgccatga 42650224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 5682346 - 5682278
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||| |||||||| ||||||||  |||||||||||||||||||  |||||||| ||||||||||||    
T  5682346 aagtcctcgctcaactagcaaaatgttgaaattgttaggccggatgttatgaccggagttcgaaccccg 5682278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 6602642 - 6602575
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  6602642 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 6602575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 6678095 - 6678028
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  6678095 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 6678028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 313 - 349
Target Start/End: Complemental strand, 7432618 - 7432582
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgtta 349  Q
    |||||||||||||||||||||||||||||||||||||    
T  7432618 aagtcctagctcaactggcaaaatgccgaaattgtta 7432582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 10286594 - 10286518
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||| | |||||||||| ||| || || |||  ||| |||||||||||||    
T  10286594 atccagaagtcctagctcaactggcaaaatgtcaaaattgttagaccgaataccgtgattgggattcgaaccccggt 10286518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 11098203 - 11098127
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||||||||| |||||||| ||||||  ||||||||||||| || ||| ||||||  ||||||||||||||||    
T  11098203 atccagaagtcctaactcaactgacaaaatatcgaaattgttaggtcgaatgtcatgactggggttcgaaccccggt 11098127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 16816827 - 16816887
Alignment:
Q  310 cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||| |||||||||||||||||||| || |||||||||||||||| ||||||| ||||||    
T  16816827 cagaactcctagctcaactggcaaaaatgtcgaaattgttaggccgaatgccataaccggg 16816887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 20993536 - 20993612
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| ||||||||||||||  |  |||||| ||||||||||||||||||||| |||| | ||||||||||||||||    
T  20993536 atccataagtcctagctcaatcgataaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggt 20993612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 306 - 350
Target Start/End: Original strand, 23554868 - 23554912
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttag 350  Q
    ||||||||| ||||||||||||||| |||||||||||||||||||    
T  23554868 tatccagaaatcctagctcaactggtaaaatgccgaaattgttag 23554912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 310 - 358
Target Start/End: Original strand, 41897826 - 41897874
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    ||||||||||| |||||||| |||||| |||||||||||||||||||||    
T  41897826 cagaagtcctaactcaactgacaaaataccgaaattgttaggccggatg 41897874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 10006151 - 10006218
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    ||||| ||||||||||||||||||| | |||||||||| ||||||| ||||| | |||||||||||||    
T  10006151 aagtcttagctcaactggcaaaatgtcaaaattgttagaccggatgtcatgatcggggttcgaacccc 10006218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 305 - 378
Target Start/End: Complemental strand, 29845216 - 29845142
Alignment:
Q  305 atatccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||| ||||||||| |||||  ||||||||||||| |||||||||||| | ||||||||||||    
T  29845216 atatccagaagtcctagttcaactggcaaaaatatcgaaattgttagg-cggatgccatgatcggggttcgaaccc 29845142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 31941164 - 31941089
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    ||||||||||| ||| |||| |||||||| ||||||||||||||||| ||||| ||||| | ||||||||||||||    
T  31941164 atccagaagtcttagttcaattggcaaaaatgccgaaattgttaggctggatgtcatgatcggggttcgaaccccg 31941089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 45406321 - 45406384
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||| ||||||||||||||  |  ||||||||||||||||||||||||||| ||||| ||||    
T  45406321 tatccaaaagtcctagctcaatcgataaaatgccgaaattgttaggccggatgtcatgatcggg 45406384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 1766713 - 1766783
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    |||||||||||||| || |||||||  |||||||||||| |||||||  |||||| |||||||||||||||    
T  1766713 aagtcctagctcaattgtcaaaatgttgaaattgttaggtcggatgctgtgaccgaggttcgaaccccggt 1766783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 3728455 - 3728381
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||||||| |||||||||| ||||||  ||||||||||||| |||||| |||||   ||||||||||||||    
T  3728455 atccagaagtcccagctcaactgacaaaatatcgaaattgttaggtcggatgtcatgattggggttcgaaccccg 3728381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 306 - 348
Target Start/End: Complemental strand, 23872841 - 23872799
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgtt 348  Q
    ||||||||||||||| |||||||||||||||||| ||||||||    
T  23872841 tatccagaagtcctaactcaactggcaaaatgccaaaattgtt 23872799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 29513878 - 29513931
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||||||||| |||| ||||||||||||||||| |||| ||||||    
T  29513878 cagaagtcctagctcaactgacaaa-tgccgaaattgttaggctggataccatga 29513931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 30089960 - 30090030
Alignment:
Q  310 cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    |||||||| |||||||||| |||||| ||||||||||||||| ||| ||||||||| | ||||||||||||    
T  30089960 cagaagtcatagctcaacttgcaaaaatgccgaaattgttagcccgaatgccatgatcggggttcgaaccc 30090030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 31261078 - 31261008
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||| | || |||||||||| ||||||||||||| |||| ||||||| | ||||||||||||||||    
T  31261078 aagtcctagattaattggcaaaatgtcgaaattgttaggtcggacgccatgatcggggttcgaaccccggt 31261008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 365
Target Start/End: Original strand, 39333944 - 39334002
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||| ||||||||||| ||||||||||||||  || ||||||||||||||| ||||||    
T  39333944 atccacaagtcctagcttaactggcaaaatgctaaacttgttaggccggatgtcatgac 39334002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 338 - 382
Target Start/End: Complemental strand, 40772663 - 40772618
Alignment:
Q  338 ccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||| | ||||||||||||||||    
T  40772663 ccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 40772618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 42922541 - 42922614
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||| ||||||||||||||||||| |||||||||| |  |||||| | ||| | ||||||||||||||||    
T  42922541 cagaagtcttagctcaactggcaaaatgtcgaaattgtttgatcggatgtcgtgatcggggttcgaaccccggt 42922614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 381
Target Start/End: Original strand, 43129101 - 43129170
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccgg 381  Q
    |||||||| |||||| |  ||||| |||||||||||||| |||||||||||| |||| ||||||||||||    
T  43129101 aagtcctatctcaaccgaaaaaataccgaaattgttaggtcggatgccatgatcgggattcgaaccccgg 43129170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 356
Target Start/End: Original strand, 1522697 - 1522741
Alignment:
Q  313 aagtcctagctcaactggc-aaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||| ||||| |||||||||||||||||||    
T  1522697 aagtcctagctcaactggcaaaaataccgaaattgttaggccgga 1522741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 316 - 382
Target Start/End: Complemental strand, 3673964 - 3673896
Alignment:
Q  316 tcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    |||||||||||||||||||| || ||||||||||||| |  |||||||||||| |||||||||| ||||    
T  3673964 tcctagctcaactggcaaaaatgtcgaaattgttaggtcatatgccatgaccgtggttcgaaccgcggt 3673896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 12534842 - 12534775
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | | ||| ||||||||||||||    
T  12534842 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaaccc 12534775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 36482186 - 36482106
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggtgcc 385  Q
    |||||||||||| ||||| |||||  |||||| |||||||||||||||| |||| |||| | |||||||||| ||| ||||    
T  36482186 tatccagaagtcttagcttaactgataaaatgtcgaaattgttaggccgaatgctatgatcggggttcgaactccgatgcc 36482106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 42192763 - 42192696
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||| ||||||||||    
T  42192763 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgagttcgaaccc 42192696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 17919919 - 17919868
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| ||| |||||||||||||||||||||||| ||||||||||| ||||    
T  17919919 aaaatgtcgatattgttaggccggatgccatgaccggggttcgaacctcggt 17919868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 358
Target Start/End: Original strand, 40216783 - 40216830
Alignment:
Q  313 aagtcctagctcaactggc-aaaatgccg-aaattgttaggccggatg 358  Q
    ||||||||||||||||||| ||||||||| ||||||||||||||||||    
T  40216783 aagtcctagctcaactggcaaaaatgccgaaaattgttaggccggatg 40216830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 376
Target Start/End: Original strand, 43330622 - 43330684
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaac 376  Q
    |||||||| |||||||| ||||||||| ||||||||||||| ||  |||||| |||||||||||    
T  43330622 aagtcctaactcaactg-caaaatgccaaaattgttaggccagacaccatgatcgggttcgaac 43330684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 377
Target Start/End: Original strand, 5917286 - 5917352
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaacc 377  Q
    ||||||||| ||||||| ||||| || ||||| |||||||||||||| ||||||| |||||||||||    
T  5917286 aagtcctagttcaactgacaaaaatgtcgaaactgttaggccggatgtcatgaccagggttcgaacc 5917352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 316 - 369
Target Start/End: Complemental strand, 25899303 - 25899249
Alignment:
Q  316 tcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||| |||||||| ||||| ||||||||||||||||||||| | ||||||||||    
T  25899303 tcctaactcaactgacaaaaatgccgaaattgttaggccggacgtcatgaccggg 25899249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 320 - 358
Target Start/End: Complemental strand, 35497752 - 35497714
Alignment:
Q  320 agctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    ||||||||||| |||||||| ||||||||||||||||||    
T  35497752 agctcaactggtaaaatgccaaaattgttaggccggatg 35497714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 365
Target Start/End: Original strand, 39303313 - 39303366
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||||    
T  39303313 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgac 39303366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 332 - 369
Target Start/End: Complemental strand, 10926190 - 10926153
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||| ||||||| |||||||||    
T  10926190 aaaatgccgaaattgttaggtcggatgctatgaccggg 10926153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 356
Target Start/End: Complemental strand, 24420116 - 24420067
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||| |||||||| ||||| |||||||||| |||||||||||| |||||    
T  24420116 atccacaagtcctaactcaattggcaaaatgtcgaaattgttagaccgga 24420067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 28183835 - 28183766
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||| ||||||||||| ||||| |||||||||| |||||||||||  | ||||| ||||||||||||||    
T  28183835 aagtcttagctcaactgacaaaaatgccgaaattattaggccggatttcttgaccggggttcgaaccccg 28183766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 28817260 - 28817304
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| ||||||||||||||  ||||||||    
T  28817260 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga 28817304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 32333118 - 32333162
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| ||||||||||||||  ||||||||    
T  32333118 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga 32333162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 380
Target Start/End: Original strand, 40418132 - 40418201
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||| ||||||||||||| |||| ||| |||||||||||||| || | ||||||||| ||||||||||||    
T  40418132 aagttctagctcaactggtaaaaatgctgaaattgttaggccagacgtcatgaccggagttcgaaccccg 40418201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 70647 - 70580
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  ||| |||| | ||||| ||||||| ||||||    
T  70647 agaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcatgacccgggtttgaaccc 70580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 4531106 - 4531039
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    |||||||||||||||| |||| ||||||||||||||  |||| ||| | ||||| ||||||||||||||    
T  4531106 agaagtcctagctcaattggc-aaatgccgaaattgcaaggctggacgtcatgacccgggttcgaaccc 4531039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 315 - 382
Target Start/End: Complemental strand, 12927347 - 12927279
Alignment:
Q  315 gtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| ||||| ||||||||||| |||||||||| |||| | ||||||| | |||||||||| |||||    
T  12927347 gtcctaactcaattggcaaaatgctgaaattgttatgccgtacgccatgatcagggttcgaactccggt 12927279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 347 - 382
Target Start/End: Original strand, 36055508 - 36055544
Alignment:
Q  347 ttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||| ||||||||||||||||    
T  36055508 ttaggccggatgccatgaccggggttcgaaccccggt 36055544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 368
Target Start/End: Complemental strand, 36442791 - 36442755
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgaccgg 368  Q
    ||||||||||||||||||||||||| | |||||||||    
T  36442791 aaaatgccgaaattgttaggccggacgtcatgaccgg 36442755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0432 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0432
Description:

Target: scaffold0432; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 307 - 385
Target Start/End: Original strand, 9366 - 9445
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  9366 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc 9445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 106)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 307 - 385
Target Start/End: Original strand, 32023251 - 32023330
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  32023251 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc 32023330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 35476620 - 35476543
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  35476620 tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt 35476543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 38490530 - 38490453
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||    
T  38490530 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccggt 38490453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 12236120 - 12236196
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  12236120 atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 12236196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 15897213 - 15897289
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  15897213 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 15897289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 20251614 - 20251538
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  20251614 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 20251538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 23080227 - 23080151
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  23080227 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 23080151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 34667043 - 34667119
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||    
T  34667043 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccccggt 34667119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 36754870 - 36754794
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||    
T  36754870 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggt 36754794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 308 - 382
Target Start/End: Original strand, 39070019 - 39070094
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  39070019 tccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 39070094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 7975144 - 7975067
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||    
T  7975144 tatccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggt 7975067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 13268105 - 13268028
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||    
T  13268105 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 13268028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 34481797 - 34481724
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||    
T  34481797 cagaagtcctagctcaactggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggt 34481724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 40592311 - 40592388
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||    
T  40592311 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaatcccggt 40592388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 42007345 - 42007268
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  42007345 tatccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt 42007268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 2287438 - 2287362
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||||||    
T  2287438 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccccggt 2287362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6731541 - 6731617
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  6731541 atccagaagtcctagctcaactagcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 6731617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10392644 - 10392720
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||    
T  10392644 atccagaagtcctagctcaactggtaaaatgccgacattgttaggccggatgccatgaccggagttcgaaccccggt 10392720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 42160386 - 42160310
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||    
T  42160386 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt 42160310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 33607041 - 33607116
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg 380  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||||||||    
T  33607041 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccagatgccatgactggggttcgaaccccg 33607116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 43461460 - 43461387
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  43461460 cagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt 43461387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 44948017 - 44948094
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||| |||||    
T  44948017 tatccagaagtcctagctcaactgacaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaactccggt 44948094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 4014944 - 4014866
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||| ||||||||||||||||| |||||||||||||||||||||||||||  ||||||| ||||||||||||||||    
T  4014944 atatccacaagtcctagctcaactgacaaaatgccgaaattgttaggccggatctcatgaccggggttcgaaccccggt 4014866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 7958113 - 7958051
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||    
T  7958113 atccagaagtcctagctcaactggcaaaataccgaaattgttgggccggatgccatgaccggg 7958051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 42200993 - 42200915
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| | ||||||||||| ||||    
T  42200993 atatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgatcggggttcgaacctcggt 42200915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 727419 - 727342
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| | |||||||||| |||||    
T  727419 tatccagaagtcctagctcaactgacaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaactccggt 727342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 23497642 - 23497565
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||| |||||||| ||||||||||||||||||||||||||| | ||||| ||||||||||||||||    
T  23497642 tatccagaagtcctagttcaactggtaaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggt 23497565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 23957050 - 23957127
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||| | ||||||||||||||||    
T  23957050 tatccagaagttctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggt 23957127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 43035438 - 43035515
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||| | ||||||||||||||||    
T  43035438 tatccagaagtcctagctcaattggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt 43035515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 45049383 - 45049460
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||| ||||||    
T  45049383 tatccagaagtcttagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggt 45049460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 3048541 - 3048617
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||| | ||||||||||||||||    
T  3048541 atccataagtcctagctcaactagcaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccggt 3048617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 24381248 - 24381320
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||| |||||||| |||||||||||||| ||||||||||||| ||||||||||||||||    
T  24381248 agaagtcctagctcaactagcaaaatgtcgaaattgttaggctggatgccatgaccggggttcgaaccccggt 24381320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 35687915 - 35687839
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||| |||| ||||||| |||||    
T  35687915 atccagaagtcctagctcaactgataaaatgccgaaattgttaggccggatgccatgatcgggattcgaactccggt 35687839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 40812016 - 40812092
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||| |||||||| ||||||||||||||||||||| |||||| ||||||| ||||||||||||||||    
T  40812016 atccagaagtcctacctcaactgacaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 40812092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 4772302 - 4772364
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  4772302 atccataagtcatagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggg 4772364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 41164778 - 41164704
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    ||||||||||||||||||||||||||||| || |||||||||||||||||||  ||||||| |||||||||||||    
T  41164778 tatccagaagtcctagctcaactggcaaagtgtcgaaattgttaggccggatatcatgaccggggttcgaacccc 41164704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 18368792 - 18368869
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||  ||||| | ||||||||||||||||    
T  18368792 tatctagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatatcatgatcggggttcgaaccccggt 18368869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 18999327 - 18999404
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |  || ||||||||||||||    
T  18999327 tatccagaagtcctaactcaactggcaaaatgccgaaattgttaggtcggatgccattattggagttcgaaccccggt 18999404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 28855544 - 28855467
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||  ||||||||| ||||||    
T  28855544 tatccggaagtcctagctcaactggcaaaatgccaaaattgttagggcggatgccatgactggggttcgaatcccggt 28855467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 321 - 380
Target Start/End: Original strand, 41196976 - 41197036
Alignment:
Q  321 gctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||    
T  41196976 gctcaactggcaaaatgccgaaattgttaagccggatgccatgaccggggttcgaaccccg 41197036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 31054046 - 31054109
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||    
T  31054046 tatccagaggtcctagctcaactggcaaaatgtcgatattgttaggccggatgccaagaccggg 31054109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 377
Target Start/End: Original strand, 35706851 - 35706922
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacc 377  Q
    ||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||  |||||||||||    
T  35706851 atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgactggggttcgaacc 35706922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 11543926 - 11543852
Alignment:
Q  310 cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||| |||||||||||||||| |||||||||||| | ||||| ||||||||||    
T  11543926 cagaagtcctagctcaactggcaaaaatgccgaaattgttaggtcggatgccatgatcggggtttgaaccccggt 11543852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 15488747 - 15488820
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc 378  Q
    |||| ||||||||||||||||||   ||||||||||||||||||||||||||| ||||||||| ||||||||||    
T  15488747 tatctagaagtcctagctcaactaataaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccc 15488820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 16535073 - 16534996
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||||||||||| |||||||  |||||| |||||||||||||||||||| ||||| ||| ||||||||||||||    
T  16535073 tatccagaagtcctagttcaactgataaaatgtcgaaattgttaggccggatgtcatgatcggagttcgaaccccggt 16534996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 23458678 - 23458755
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| |||||||| ||||||||| ||||||| ||||||||||||| |||| |||||||| ||||||||||||||||    
T  23458678 tatccacaagtcctaactcaactggaaaaatgctgaaattgttaggctggataccatgaccggggttcgaaccccggt 23458755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 323 - 378
Target Start/End: Complemental strand, 15920727 - 15920671
Alignment:
Q  323 tcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  15920727 tcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc 15920671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 16010742 - 16010666
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||||||| ||||||||||| ||||||| | |||| | ||||||||||||||||    
T  16010742 atccagaagtcgtagctcaactggcaaaatgtcgaaattgttaagccggatactatgatcggggttcgaaccccggt 16010666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 32120613 - 32120680
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||| |||||| | ||||||||||||    
T  32120613 agaagtcctagctcaactggcaaaatg-cgaaattgttaggccggataccatgatcggggttcgaaccc 32120680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 34242576 - 34242504
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||  ||||| | ||||||||||||||||    
T  34242576 agaagtcctagctcaactgataaaatgccgaaattgttaggccggatatcatgatcggggttcgaaccccggt 34242504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 36794803 - 36794879
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||| | |||||||||||||| ||||||||| | ||||||||||| ||||    
T  36794803 atccagaagtcctagctcaactggtaaaatgtcaaaattgttaggccgaatgccatgatcggggttcgaacctcggt 36794879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 16368814 - 16368755
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| ||||    
T  16368814 cagaagtcctagctcatctggcaaaataccgaaattgttaggccggatgtcatgatcggg 16368755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 380
Target Start/End: Original strand, 38463141 - 38463212
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||| ||||||||||||||||||||||||||||||||| ||||||  |||| | ||||||||||||||    
T  38463141 cagaagtcttagctcaactggcaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaaccccg 38463212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 365
Target Start/End: Complemental strand, 42133568 - 42133513
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    |||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||    
T  42133568 cagaagtcttagttcaactggcaaaatgccgaaattgttaggtcggatgccatgac 42133513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 42211276 - 42211351
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg 380  Q
    |||||||||||| ||| |||||||| |||||| |||||||||||||||| |||| ||||||||| |||||||||||    
T  42211276 tatccagaagtcttagttcaactggtaaaatgtcgaaattgttaggccgcatgctatgaccgggattcgaaccccg 42211351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 42414529 - 42414580
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  42414529 aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 42414580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 359
Target Start/End: Complemental strand, 11816907 - 11816853
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgc 359  Q
    |||||||||||||||||||||| ||| |||||| |||||||||||||||||||||    
T  11816907 atatccagaagtcctagctcaattggtaaaatgtcgaaattgttaggccggatgc 11816853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 31516336 - 31516258
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||| |||||||| ||||||||| |||||||||||||||||||||||||  |||||| | ||||||||||| ||||    
T  31516336 atatccacaagtcctaactcaactggaaaaatgccgaaattgttaggccggaaaccatgatcagggttcgaacctcggt 31516258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 38140696 - 38140766
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||| ||||||||| |||||||||||||||||| |||||||| ||||| | ||||||||||||||||    
T  38140696 aagtcctaactcaactggtaaaatgccgaaattgttaagccggatgtcatgatcggggttcgaaccccggt 38140766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 303 - 360
Target Start/End: Original strand, 433133 - 433190
Alignment:
Q  303 acatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgcc 360  Q
    |||||||||||||||||| |||||||| ||||||| |||||||||||||| |||||||    
T  433133 acatatccagaagtcctaactcaactgacaaaatgtcgaaattgttaggctggatgcc 433190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 305 - 381
Target Start/End: Original strand, 11061380 - 11061456
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccgg 381  Q
    |||| ||||||||||| ||||||||  |||||| |||||||||||||||||||| ||||||| |||||||||||||||    
T  11061380 atattcagaagtcctaactcaactgataaaatgtcgaaattgttaggccggatg-catgaccggggttcgaaccccgg 11061456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 366
Target Start/End: Complemental strand, 7607370 - 7607310
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc 366  Q
    |||||||||||||||||||| || ||||| || ||||||||||||||||||||||||||||    
T  7607370 atccagaagtcctagctcaattgacaaaaatgtcgaaattgttaggccggatgccatgacc 7607310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 19048758 - 19048825
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||| |||||||| | ||||| ||||||||||||||    
T  19048758 agaagtcctagctcaactggc-aaatgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc 19048825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 19134647 - 19134571
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||||| |||||||||||||||||| |||| || ||||||||||||||| |||||| ||||||| ||||||||||||    
T  19134647 tatccataagtcctagctcaactggaaaaaatgtcgaaattgttaggccagatgccgtgaccggagttcgaaccccg 19134571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 380
Target Start/End: Complemental strand, 31525083 - 31525007
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||| |||| |||||||||||| ||||||||||||||||||| |||| |  |||||||||| ||||||||||||    
T  31525083 atatccacaagttctagctcaactgacaaaatgccgaaattgttatgccgaaaaccatgaccggagttcgaaccccg 31525007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 39218680 - 39218756
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||| | | |||||||||||||||||||| ||||||  |||| | ||||||||||||||||    
T  39218680 atccagaagtcctagctcaattcgaaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaaccccggt 39218756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 314 - 379
Target Start/End: Complemental strand, 12221267 - 12221200
Alignment:
Q  314 agtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||||||||||||||||| ||  ||||||||||||||||| ||||||||| |||||||||||||    
T  12221267 agtcctagctcaactggcaaaaatgatgaaattgttaggccggacgccatgaccagggttcgaacccc 12221200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 8859416 - 8859342
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||||| |||| |||||| |||||||| |||||||||||||||||||| |||||   ||||||||||||||    
T  8859416 atccagaagttctagttcaactagcaaaatgtcgaaattgttaggccggatgtcatgattggggttcgaaccccg 8859342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 367
Target Start/End: Original strand, 31819643 - 31819697
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    |||||||| |||||||||||||||| ||||||| |||||||||||| ||||||||    
T  31819643 aagtcctaactcaactggcaaaatgtcgaaattattaggccggatggcatgaccg 31819697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 315 - 376
Target Start/End: Original strand, 39417449 - 39417511
Alignment:
Q  315 gtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgggttcgaac 376  Q
    ||||||||||||||| ||||| | ||||||||||||||||||||| |||||| ||||||||||    
T  39417449 gtcctagctcaactgacaaaaataccgaaattgttaggccggatgtcatgacggggttcgaac 39417511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 4695121 - 4695048
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    |||||||| |||||||| ||||||||||||| |||||||||| || |||||| ||||| | |||||||||||||    
T  4695121 atccagaaatcctagcttaactggcaaaatgtcgaaattgttcggtcggatgtcatgatcagggttcgaacccc 4695048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 11011975 - 11012047
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaacccc 379  Q
    ||||| |||||||||||||||| ||||| ||| ||||||||||||| ||||||||||| ||| |||||||||||    
T  11011975 atccacaagtcctagctcaactagcaaa-tgctgaaattgttaggctggatgccatgatcggagttcgaacccc 11012047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 25510427 - 25510382
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    |||||||||||||||||||| ||||| |||||||||||||||||||    
T  25510427 agaagtcctagctcaactggtaaaataccgaaattgttaggccgga 25510382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 39310368 - 39310441
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||| |||||||  ||||||||||||||||||||  |||| | |||||||||| |||||    
T  39310368 cagaagtcctagctcaactagcaaaatatcgaaattgttaggccggatgttatgatcggggttcgaactccggt 39310441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 10639730 - 10639663
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  10639730 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 10639663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 18779914 - 18779986
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| |||| ||| |||||| ||||||||||||| |||||||||||||| || |||||||| ||||    
T  18779914 agaagtcctagttcaattggtaaaatgtcgaaattgttaggtcggatgccatgaccaggcttcgaaccacggt 18779986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 33083678 - 33083611
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  33083678 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 33083611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 16178264 - 16178331
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    |||||||||||||||||  ||||||||||||||||||||  ||| ||||||| | |||||||||||||    
T  16178264 aagtcctagctcaactgaaaaaatgccgaaattgttaggtaggacgccatgatcggggttcgaacccc 16178331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 337 - 382
Target Start/End: Original strand, 8532135 - 8532181
Alignment:
Q  337 gccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||| |||||| ||||||||||||||||    
T  8532135 gccgaaattgttaggccggatgctatgaccggggttcgaaccccggt 8532181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 12541467 - 12541389
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||| |||| |||| |||||||| ||||| |||||||||||||| |||||| ||||| | ||||||||||| ||||    
T  12541467 atatccacaagtactaggtcaactggtaaaataccgaaattgttaggtcggatgtcatgatcggggttcgaacctcggt 12541389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 18469560 - 18469514
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccg 354  Q
    |||| ||||||||||||||||||| ||||| ||||||||||||||||    
T  18469560 tccataagtcctagctcaactggctaaatgtcgaaattgttaggccg 18469514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 376
Target Start/End: Original strand, 5887569 - 5887637
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaac 376  Q
    ||||||||||||||| ||||||||| |||||| |   |||||||||||||||| ||||||| ||||||||||    
T  5887569 tatccagaagtcctaactcaactggtaaaatgtc---attgttaggccggatgtcatgaccagggttcgaac 5887637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 11708682 - 11708726
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| ||||||||||||||| ||||||||    
T  11708682 agaagtcctagctcaactggc-aaatgccgaaattgtaaggccgga 11708726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 12847085 - 12847012
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||| ||| ||||||||| ||||| || |||||||||||| ||||| ||||| | ||||||||||||    
T  12847085 tatccagaagttctaactcaactggtaaaataccaaaattgttaggctggatgtcatgatcagggttcgaaccc 12847012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 336 - 380
Target Start/End: Original strand, 13622983 - 13623028
Alignment:
Q  336 tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||||||||||||||||||||| ||||||| ||||||||||||    
T  13622983 tgccgaaattgttaggccggatgccgtgaccggagttcgaaccccg 13623028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 354
Target Start/End: Original strand, 19967739 - 19967780
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccg 354  Q
    |||||||||||||||||||||||| |||||||||||| ||||    
T  19967739 aagtcctagctcaactggcaaaataccgaaattgttaagccg 19967780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 322 - 382
Target Start/End: Complemental strand, 37198845 - 37198784
Alignment:
Q  322 ctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||| ||||||| ||||||||||||||| |||| ||||| | ||||||||||||||||    
T  37198845 ctcaactgacaaaatgtcgaaattgttaggccagatggcatgatcggggttcgaaccccggt 37198784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 380
Target Start/End: Complemental strand, 37644337 - 37644288
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||| |||||||||||||||||||||||||| | ||||||||||||||    
T  37644337 aaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccg 37644288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 42030243 - 42030299
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    ||||||||||||||||||||| || |||||| ||||||||||||| |||||| |||||    
T  42030243 atccagaagtcctagctcaac-ggtaaaatgtcgaaattgttaggtcggatgtcatga 42030299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 45125289 - 45125245
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| ||||||||||||||| ||||||||    
T  45125289 agaagtcctagctcaactggc-aaatgccgaaattgtaaggccgga 45125245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 11459719 - 11459786
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  ||| |||| | ||||| ||||||||||||||    
T  11459719 agaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcatgacccgggttcgaaccc 11459786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 351
Target Start/End: Complemental strand, 29741087 - 29741043
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttagg 351  Q
    |||||||||||||||||||||||| |||||| ||||||| |||||    
T  29741087 atccagaagtcctagctcaactggaaaaatgtcgaaattattagg 29741043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 499887 - 499824
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||| ||||||| |||| |||||||| |||||||||||||||| | |||||||||| ||||    
T  499887 atccagacgtcctagttcaattggcaaaaatgccgaaattgttaggtcagatgccatgatcggg 499824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 364
Target Start/End: Complemental strand, 7315884 - 7315833
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    ||||||||||||||||  |||||||| ||||||||||| |||||| ||||||    
T  7315884 aagtcctagctcaactaacaaaatgctgaaattgttagaccggataccatga 7315833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 308 - 378
Target Start/End: Complemental strand, 11816678 - 11816608
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||||| ||||||||||||||  ||| |||| | | ||||| ||||||||||||    
T  11816678 tccagaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcgtgacctgggttcgaaccc 11816608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 377
Target Start/End: Original strand, 13491030 - 13491096
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaacc 377  Q
    ||||| ||||||||||||||||| | |||||||||||| |||||| | ||||||| |||||||||||    
T  13491030 aagtcatagctcaactggcaaaaataccgaaattgttatgccggacgtcatgaccggggttcgaacc 13491096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 320 - 369
Target Start/End: Original strand, 33898242 - 33898292
Alignment:
Q  320 agctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||| |||||||| || |||||||||||||||||||| ||||||||||    
T  33898242 agctcaattggcaaaaatgtcgaaattgttaggccggatgtcatgaccggg 33898292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 358
Target Start/End: Original strand, 43696410 - 43696460
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    |||| ||||| |||||||||||  |||||||||||||| ||||||||||||    
T  43696410 tccacaagtcttagctcaactgaaaaaatgccgaaattattaggccggatg 43696460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 320 - 369
Target Start/End: Complemental strand, 11091702 - 11091653
Alignment:
Q  320 agctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||| |||||||||||||||||||||| | |||| ||||| ||||    
T  11091702 agctcaactagcaaaatgccgaaattgttaggtcagatgtcatgatcggg 11091653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 306 - 377
Target Start/End: Original strand, 18055856 - 18055929
Alignment:
Q  306 tatccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacc 377  Q
    |||||| |||||||||||||| |||| |||||| | |||||| ||||||||||| ||||| | |||||||||||    
T  18055856 tatccataagtcctagctcaattggcaaaaatgtcaaaattgctaggccggatgtcatgatcggggttcgaacc 18055929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 26605628 - 26605672
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| ||||||||||||||  ||||||||    
T  26605628 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga 26605672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 377
Target Start/End: Complemental strand, 39831565 - 39831501
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacc 377  Q
    ||||||||||||||||||| |||| |||||||||  |||||||| | ||||| |||||||||||||    
T  39831565 aagtcctagctcaactggc-aaataccgaaattgcaaggccggacgtcatgatccgggttcgaacc 39831501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 318 - 363
Target Start/End: Original strand, 44887134 - 44887179
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatg 363  Q
    |||| ||||||||||||||| |||||||||| ||||||||| ||||    
T  44887134 ctagttcaactggcaaaatgtcgaaattgttgggccggatgtcatg 44887179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 7276011 - 7275943
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccat-gaccgggttcgaaccc 378  Q
    |||||||||| |||||||| ||||||||||||||||  ||| |||||| | | | ||||||||||||||    
T  7276011 agaagtcctaactcaactgacaaaatgccgaaattgcaaggtcggatgtcgtggcccgggttcgaaccc 7275943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 305 - 349
Target Start/End: Complemental strand, 21840579 - 21840536
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgtta 349  Q
    ||||||||||||||||||||||||| | ||||| |||||||||||    
T  21840579 atatccagaagtcctagctcaactgac-aaatgtcgaaattgtta 21840536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 356
Target Start/End: Complemental strand, 25501910 - 25501863
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    |||||||||||||||||||||||| |||||| |||||||  ||||||||    
T  25501910 tccagaagtcctagctcaactggc-aaatgctgaaattgcaaggccgga 25501863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0402 (Bit Score: 71; Significance: 5e-32; HSPs: 1)
Name: scaffold0402
Description:

Target: scaffold0402; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 1372 - 1294
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  1372 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 1294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 71; Significance: 5e-32; HSPs: 145)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 8381076 - 8381154
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  8381076 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 8381154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 13525167 - 13525244
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  13525167 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 13525244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 4232306 - 4232230
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  4232306 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 4232230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 4833238 - 4833162
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  4833238 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 4833162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 307 - 385
Target Start/End: Complemental strand, 6583364 - 6583285
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggtgcc 385  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||    
T  6583364 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtgcc 6583285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 29212196 - 29212118
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  29212196 atatccataagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 29212118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 4976838 - 4976761
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||    
T  4976838 tatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggt 4976761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 6083272 - 6083195
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||    
T  6083272 atatccagaagtcctagctcaactagcaaaatgccgaaattgttaggccggataccatgaccgggttcgaactccggt 6083195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 24650677 - 24650600
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  24650677 tatccagaagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 24650600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 3917765 - 3917841
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  3917765 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 3917841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 24250723 - 24250803
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||    
T  24250723 tatccagaagtcctagctcaattggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtgcc 24250803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 32961107 - 32961031
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||    
T  32961107 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggt 32961031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 30553098 - 30553023
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||    
T  30553098 tatccagaagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgaccggagttcgaaccccg 30553023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 41464662 - 41464736
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||    
T  41464662 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaacccc 41464736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 381
Target Start/End: Complemental strand, 28171110 - 28171033
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccgg 381  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||    
T  28171110 tatccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccgg 28171033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 11312593 - 11312665
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||    
T  11312593 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggt 11312665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 27396853 - 27396925
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  27396853 atccagaagtcctagctcaactgacaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc 27396925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 28266524 - 28266604
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||    
T  28266524 tatccagaagtcctagctcaactgacaaaatgccgaaattgttaggctggatgccatgaccggggttcgaactccggtgcc 28266604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 38127971 - 38127895
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||||    
T  38127971 atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggt 38127895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 43605705 - 43605629
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||    
T  43605705 atccagaagtcctagctcaactggcaaaatgctgaatttgttaggccggatgccatgaccggggttcgaaccccggt 43605629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 43898092 - 43898016
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  43898092 atccagaagtcctagctcaacagacaaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggt 43898016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 369
Target Start/End: Complemental strand, 46838858 - 46838794
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  46838858 atatccagaagtcctagctcaactggaaaaatgccgaaattgttaggccggatgccatgaccggg 46838794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 54097569 - 54097493
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||    
T  54097569 atccagaagtcctagctcaaatggcaaaatgccgaaattgttaggccggatgccatgaccggggttggaaccccggt 54097493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 307 - 377
Target Start/End: Original strand, 22371449 - 22371520
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacc 377  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  22371449 atccagaagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacc 22371520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 304 - 382
Target Start/End: Original strand, 35069309 - 35069388
Alignment:
Q  304 catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  35069309 catatcaagaagtcttagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 35069388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 10474037 - 10473967
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
T  10474037 aagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggt 10473967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 47069004 - 47069082
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  47069004 tatccagaagtcttagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 47069082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 2687557 - 2687630
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||    
T  2687557 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatggcatgatcggggttcgaaccc 2687630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 2789108 - 2789031
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||    
T  2789108 tatccagaagtcctagttcaactggcaaaatgccgaaattattaggcctgatgccatgaccggggttcgaaccccggt 2789031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 40840171 - 40840244
Alignment:
Q  311 agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  40840171 agaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 40840244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 1242220 - 1242292
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||    
T  1242220 agaagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgatcggggttcgaaccccggt 1242292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 27002869 - 27002793
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| | ||||||||||||||    
T  27002869 atccagaagtcctagctcaactggcaaagtgccgaaattgttaagccggatgccatgaccagagttcgaaccccggt 27002793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 34397677 - 34397753
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||    
T  34397677 atatccagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatgtcataaccggggttcgaaccccg 34397753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 35359716 - 35359792
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| ||  |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  35359716 atccagaagtcttaattcaactggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggt 35359792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 15003625 - 15003703
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||    
T  15003625 atatccagaagtcctagttcaactggcaaaatgccaaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 15003703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 17500926 - 17500988
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||    
T  17500926 atccagaagtcctaactcaactggaaaaatgccgaaattgttaggccggatgccatgaccggg 17500988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 32590969 - 32591047
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| | ||||||||| ||||||    
T  32590969 atatccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaatcccggt 32591047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 42296709 - 42296786
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| ||||||||||||||||    
T  42296709 atatccagaagtcctagctcaactg-caaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggt 42296786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 46894812 - 46894886
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg 380  Q
    ||||||||||||||||||||||| ||||||  ||||||||||||||||||||||||||||| |||||||||||||    
T  46894812 atccagaagtcctagctcaactgacaaaatatcgaaattgttaggccggatgccatgaccgaggttcgaaccccg 46894886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 53583960 - 53584022
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||    
T  53583960 atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggattccatgaccggg 53584022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 8507930 - 8508007
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||  |||||| |||||||||    
T  8507930 tatccagaagtcttagctcaactggaaaaatgccgaaattgttaggccggatgccatgactggggttcaaaccccggt 8508007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 11029662 - 11029739
Alignment:
Q  307 atccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||| ||||||||||||||||    
T  11029662 atccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggctggatgccatgaccagggttcgaaccccggt 11029739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 11751210 - 11751287
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||    
T  11751210 atccataagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatcaccggggttcgaaccccggt 11751287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 24910418 - 24910341
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||  ||||| | ||||||||||||||||    
T  24910418 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggctggatatcatgatcggggttcgaaccccggt 24910341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 25118836 - 25118759
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| ||||||| |||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  25118836 tatctagaagtcttagctcaactagcaaaatgtcgaaattgttaggccggatgccatgaccagggttcgaaccccggt 25118759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 24657410 - 24657486
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||| |||||||| |||||||||||||||||||||| |||||||||| || ||||||||||||||||    
T  24657410 atccagaagtcctaactcaactgacaaaatgccgaaattgttaggcaggatgccatggccagggttcgaaccccggt 24657486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 24751752 - 24751824
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||    
T  24751752 atccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccc 24751824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 37124215 - 37124291
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||    
T  37124215 atccagaagtcatagctctactggcaaaatgccgaaattgttaggccgaatgccatgaccggggttcgaacctcggt 37124291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 44107379 - 44107455
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    |||||| |||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||| ||||    
T  44107379 tatccacaagttctagctcaactggcaaaatgttgaaattgttaggccggatgccatgaccggggtcgaacctcggt 44107455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 47410881 - 47410809
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||| ||||||||||||    
T  47410881 atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggggttcgaaccc 47410809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 10047870 - 10047933
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||||||||||    
T  10047870 tatccagaagtcctagctcaattggtaaaatgccgaaattgttatgccggatgccatgaccggg 10047933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 380
Target Start/End: Original strand, 12948812 - 12948883
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    ||||||||||||||||||||| |||||| |||||||||||||||||||||||||| | ||||||||||||||    
T  12948812 cagaagtcctagctcaactggtaaaatgacgaaattgttaggccggatgccatgatcggggttcgaaccccg 12948883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 19921442 - 19921368
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacccc 379  Q
    ||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||| | ||||||||||||    
T  19921442 tatccagaagtcctagctcaattggcaaaatgctgaaattgttaggtcggatgccatgactgaggttcgaacccc 19921368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 305 - 378
Target Start/End: Complemental strand, 40193087 - 40193013
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc 378  Q
    ||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||| ||| ||||||||||    
T  40193087 atatccagaagtcctagcttaactggtaaaatgtcgaaattgttaggccggatgccatgatcggagttcgaaccc 40193013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 3440736 - 3440801
Alignment:
Q  319 tagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  3440736 tagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 3440801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 47408839 - 47408896
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||    
T  47408839 atccagaagtcctagctcaactagcaaaatgccgaaattgttaggccggataccatga 47408896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 50238966 - 50238893
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||| |||||||| |||||    
T  50238966 cagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgatcggagttcgaactccggt 50238893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10228956 - 10229032
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| || |||||||||||||||||| |||||||||||||| ||| ||||||| ||||||||||||||||    
T  10228956 atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggt 10229032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 14868983 - 14868908
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||| ||||| ||||||||||    
T  14868983 atccagaagtcctagctcaactggcaaa-tgccgaaattgttaggctggataccatgaccggggtttgaaccccggt 14868908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 365
Target Start/End: Complemental strand, 24274011 - 24273951
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
T  24274011 atatctagaagtcctaactcaactgacaaaatgccgaaattgttaggccggatgccatgac 24273951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 44037573 - 44037497
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||| || |||||||| ||||||    
T  44037573 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcgtgatcgaggttcgaatcccggt 44037497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 310 - 378
Target Start/End: Complemental strand, 46311569 - 46311502
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc 378  Q
    ||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||| |||||||||||    
T  46311569 cagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgctatgacc-ggttcgaaccc 46311502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 53669836 - 53669764
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||| ||||||||||||| ||||||| |||||||||||||||||||||||||| || ||||||||||||||    
T  53669836 agaagttctagctcaactggtaaaatgctgaaattgttaggccggatgccatgactggagttcgaaccccggt 53669764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 331 - 385
Target Start/End: Original strand, 9609955 - 9610010
Alignment:
Q  331 caaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  9609955 caaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc 9610010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 48191096 - 48191155
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||| ||||||||||    
T  48191096 cagaagtcctagctcaactgctaaaatgccgaaattgttaggccggatgtcatgaccggg 48191155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 325 - 382
Target Start/End: Complemental strand, 28197095 - 28197037
Alignment:
Q  325 aactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  28197095 aactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 28197037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 8826623 - 8826700
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||| | |||||||||||||||||||| |||||||| |||| | ||| ||||||||||||    
T  8826623 tatccagaagtcctagctcaacggacaaaatgccgaaattgttagaccggatgctatgatcggggctcgaaccccggt 8826700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 319 - 382
Target Start/End: Complemental strand, 1218488 - 1218424
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||| ||||    
T  1218488 tagctcaactggtaaaatgccgaaattgttaggccggatgccatgatcggggttcgaacctcggt 1218424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 367
Target Start/End: Original strand, 2900254 - 2900314
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    |||||||||||||||||| |||||||||||||||||||||||| |||||||| ||| ||||    
T  2900254 atccagaagtcctagctccactggcaaaatgccgaaattgttaagccggatgtcataaccg 2900314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 11249959 - 11250031
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||| |||||||||||| | ||||||||||||    
T  11249959 atccacaagtcctagctcaactggtaaaatgcagaaattgttaggtcggatgccatgatcggggttcgaaccc 11250031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 371
Target Start/End: Original strand, 18271576 - 18271640
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggtt 371  Q
    |||||||||| ||| |||||||| ||||||||||||||||||||| |||||||||||| ||||||    
T  18271576 atccagaagttctaactcaactgacaaaatgccgaaattgttaggtcggatgccatgatcgggtt 18271640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 23878943 - 23879019
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||| |||||||||||||||||| |||||||| ||||||||||||| |||| |||||| || ||||||||||||    
T  23878943 atatccacaagtcctagctcaactggaaaaatgcctaaattgttaggccagatgtcatgactggagttcgaaccccg 23879019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 308 - 379
Target Start/End: Original strand, 37312528 - 37312600
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacccc 379  Q
    ||||||||||||||||||||||| ||||| ||||||||||||||||||| ||| ||||  |||||||||||||    
T  37312528 tccagaagtcctagctcaactggtaaaataccgaaattgttaggccggacgccttgacgggggttcgaacccc 37312600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 369
Target Start/End: Original strand, 40559671 - 40559735
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||||  |||||||||||||||||||| |||||||| ||| ||||    
T  40559671 atatccagaagtcctagctcaactgataaaatgccgaaattgttaggtcggatgccttgatcggg 40559735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 48555835 - 48555911
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| |||||||| |||||||||||||||||| ||||||||||||| ||||| ||| || ||||||||||||||||    
T  48555835 atccataagtcctacctcaactggcaaaatgccaaaattgttaggccagatgctatggccggggttcgaaccccggt 48555911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 385
Target Start/End: Complemental strand, 51112589 - 51112514
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    ||||||||||||||||||||||||| ||||||||||| ||||||||| | ||||||| ||||||||||||| |||||    
T  51112589 cagaagtcctagctcaactggcaaa-tgccgaaattgctaggccggacgtcatgaccggggttcgaaccccagtgcc 51112514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 9583553 - 9583490
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||| | ||||||||||||||||| |||||||||||||||||||||||| |||||||||    
T  9583553 atccagaagccttagctcaactggcaaaaatgccgaaattgttaggccggatgctatgaccggg 9583490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 44879358 - 44879287
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||| ||||||||||||||| |||| |||||||||| |  |||||||||    
T  44879358 agaagtcctagttcaactggcaaaatgtcgaaattgttaggccagatgtcatgaccggggttcaaccccggt 44879287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 8792860 - 8792782
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||| || |||| ||||||||||||||||| |||||||||||   ||||||||||||||||    
T  8792860 tatccagaagtcctagctcaaccggtaaaaatgccgaaattgttaggctggatgccatgattggggttcgaaccccggt 8792782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 349
Target Start/End: Complemental strand, 21402787 - 21402745
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgtta 349  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  21402787 atccagaagtcctagctcaactggcaaaatgccgaaattgtta 21402745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 28731844 - 28731922
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||| |||||||||||| ||||||| ||||||||||||| |||||||||||| | ||||||||| ||||||    
T  28731844 atatctagaagttctagctcaactgacaaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaatcccggt 28731922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 41921508 - 41921562
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    ||||||||||||||||||||| |||||||||||||||||||||| |||| |||||    
T  41921508 cagaagtcctagctcaactggtaaaatgccgaaattgttaggccagatgtcatga 41921562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 12088412 - 12088335
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||| |||  ||| |||||| ||||||||||||||||||||| |||| | ||||||||||||||||    
T  12088412 tatccagaagtcctagatcacttggaaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggt 12088335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 38085804 - 38085881
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||| |||||||||||||| ||||||| |||||||||||||||| ||| ||||| | ||| ||||||||||||    
T  38085804 tatccagaaatcctagctcaactgacaaaatgtcgaaattgttaggccgaatgacatgatcggggctcgaaccccggt 38085881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 43426566 - 43426643
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||| |||| ||| ||||||||||  |||||||||||||||||||| | |||||||||||||| ||||||||||||||    
T  43426566 tatcaagaaatcccagctcaactgaaaaaatgccgaaattgttaggtcagatgccatgaccggagttcgaaccccggt 43426643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 43967926 - 43967999
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| ||||||||||||||| ||| ||| ||||||||||||||||||| ||||| | ||||||||||||||||    
T  43967926 cagaaatcctagctcaactggtaaagtgctgaaattgttaggccggatgtcatgatcagggttcgaaccccggt 43967999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 52256878 - 52256805
Alignment:
Q  311 agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| |||||||||||||||||| || ||| |||||||||| ||||||||||||| ||||||||||||||||    
T  52256878 agaagttctagctcaactggcaaaaatgtcgatattgttaggctggatgccatgaccggggttcgaaccccggt 52256805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 19961368 - 19961444
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||||||||| |||||||| ||||||| ||||||||||||| |||||| ||||||  ||||||| ||||||||    
T  19961368 atccagaagtcctaactcaactgacaaaatgtcgaaattgttaggtcggatgtcatgactggggttcgtaccccggt 19961444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 32946482 - 32946406
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    ||||||||||||||| |||||||| |||||||| |||||||||| | ||||| |||||| | |||||||||| ||||    
T  32946482 tatccagaagtcctaactcaactgtcaaaatgctgaaattgttaagtcggattccatgatcaggttcgaaccacggt 32946406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 40418604 - 40418528
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||| || ||||||| ||||||||||||||  ||| ||||| | ||||||||||||||||    
T  40418604 atccagaagtcctagctcaacaggaaaaatgctgaaattgttaggccaaatgtcatgatcggggttcgaaccccggt 40418528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 308 - 379
Target Start/End: Original strand, 40639602 - 40639674
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacccc 379  Q
    ||||||||| ||||||||||||| ||||| ||||||||||||||||||| ||| ||||  |||||||||||||    
T  40639602 tccagaagttctagctcaactggtaaaataccgaaattgttaggccggacgccttgacgggggttcgaacccc 40639674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 316 - 378
Target Start/End: Complemental strand, 16687668 - 16687606
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||| ||||||||||||||||||||||||||||  |||||||| ||||||||||||    
T  16687668 tcctagctcaaccggcaaaatgccgaaattgttaggccgga-cccatgaccggggttcgaaccc 16687606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 365
Target Start/End: Original strand, 17373669 - 17373728
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    |||||| ||||| ||||||| |||| |||||||||||||||||| |||||||||||||||    
T  17373669 tatccacaagtcttagctcagctggtaaaatgccgaaattgttaagccggatgccatgac 17373728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 382
Target Start/End: Complemental strand, 33886478 - 33886423
Alignment:
Q  328 tggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||    
T  33886478 tggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 33886423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 315 - 369
Target Start/End: Original strand, 2558754 - 2558808
Alignment:
Q  315 gtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||| |||||||||||| |||||| ||||| ||||    
T  2558754 gtcctagctcaactggcaaaatgctgaaattgttaggtcggatgtcatgatcggg 2558808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 333 - 382
Target Start/End: Complemental strand, 8128393 - 8128343
Alignment:
Q  333 aaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  8128393 aaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 8128343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 9493499 - 9493573
Alignment:
Q  310 cagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||| |  |||||| |||||||||||||| ||||||||||||  ||||||||||||||||    
T  9493499 cagaagtcctagctcaacttgataaaatgtcgaaattgttaggctggatgccatgactggggttcgaaccccggt 9493573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 333 - 382
Target Start/End: Original strand, 35240055 - 35240105
Alignment:
Q  333 aaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||| ||||| ||||||||||||||||    
T  35240055 aaatgccgaaattgttaggccggatgccttgaccggggttcgaaccccggt 35240105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 334 - 382
Target Start/End: Complemental strand, 2096687 - 2096638
Alignment:
Q  334 aatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||| ||||||||||||| ||||||||||||||||    
T  2096687 aatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggt 2096638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 376
Target Start/End: Complemental strand, 35755800 - 35755735
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaac 376  Q
    ||||||| |||||| |||| |||||||||||||||||||| || |||||||||| |||| ||||||    
T  35755800 agaagtcttagctcgactgacaaaatgccgaaattgttagaccagatgccatgatcggggtcgaac 35755735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 364
Target Start/End: Complemental strand, 42483052 - 42482999
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||||||||  ||||||||||||||||||| ||||||| |||||    
T  42483052 agaagtcctagctcaactgagaaaatgccgaaattgttagaccggatgtcatga 42482999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 4601429 - 4601496
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  4601429 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 4601496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 5998909 - 5998835
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||| ||| |||| |||||||||||||||| | ||| |||||||| ||||||||||||||||    
T  5998909 atccagaagtcctagctcatctgacaaa-tgccgaaattgttagg-ctgataccatgaccggggttcgaaccccggt 5998835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 316 - 379
Target Start/End: Original strand, 7552603 - 7552667
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||| |||| | ||||| ||||||||||||||||||||||| ||||| |||||||||||||    
T  7552603 tcctagcttaactagtaaaataccgaaattgttaggccggatgccgtgaccggggttcgaacccc 7552667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 7824578 - 7824511
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  7824578 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 7824511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 29689606 - 29689539
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  29689606 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 29689539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 30703088 - 30703164
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||| |||||||||||||||| |||||||| |  |||||||||||||| ||||| ||||||| ||||||||||||||    
T  30703088 tatcgagaagtcctagctcaattggcaaaaatatcgaaattgttaggctggatgtcatgaccggggttcgaaccccg 30703164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 43904622 - 43904562
Alignment:
Q  310 cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||| ||||||||||||  |||| || |||||||||||||||||||||||||||||||    
T  43904622 cagaagttctagctcaactgaaaaaaatgtcgaaattgttaggccggatgccatgaccggg 43904562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 51666049 - 51665982
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||||| ||||||||||||    
T  51666049 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacctgggttcgaaccc 51665982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 54151805 - 54151738
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  54151805 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 54151738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 54158270 - 54158337
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  54158270 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgatccgggttcgaaccc 54158337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 32635387 - 32635454
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||| ||||||||||||| ||||||| ||||| |||||| ||||| | ||||||||||||||||    
T  32635387 tcctagcttaactggcaaaatgtcgaaattattaggtcggatgtcatgatcggggttcgaaccccggt 32635454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 358
Target Start/End: Complemental strand, 45475357 - 45475310
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    ||||| |||||||||||||| ||||| |||||||||||||||||||||    
T  45475357 agaagacctagctcaactggtaaaataccgaaattgttaggccggatg 45475310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 366
Target Start/End: Original strand, 46828893 - 46828952
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc 366  Q
    ||||| |||||  |||||||||| ||||||| ||||||| ||||||||||||||||||||    
T  46828893 atccacaagtctcagctcaactgacaaaatgtcgaaattattaggccggatgccatgacc 46828952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 377
Target Start/End: Original strand, 52500842 - 52500908
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacc 377  Q
    ||||||||||||||||||||| ||||| ||||||||| |||||||| | ||||| |||||||||||||    
T  52500842 agaagtcctagctcaactggc-aaatgtcgaaattgtaaggccggacgtcatgatccgggttcgaacc 52500908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 33746100 - 33746030
Alignment:
Q  313 aagtcctagctcaactggca-aaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    |||||||| |||| ||| || ||||||||||||||||||| |||||| |||||| |||||| |||||||||    
T  33746100 aagtcctaactcagctgacacaaatgccgaaattgttaggtcggatgtcatgactgggttcaaaccccggt 33746030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 36540108 - 36540178
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg 380  Q
    ||||||||||| |||| ||| |||||| ||||||||||||||| |||| |||||| | |||||||||||||    
T  36540108 agaagtcctagttcaagtggtaaaatgtcgaaattgttaggccagatgtcatgactgaggttcgaaccccg 36540178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 323 - 382
Target Start/End: Original strand, 1562809 - 1562870
Alignment:
Q  323 tcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||| |||||||||||||||| |||||| ||||| | ||||||||||||||||    
T  1562809 tcaactggcaaaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccggt 1562870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 47570281 - 47570358
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| ||||||||||||||||  ||||||| | ||||||||| |||||||| ||| | | ||||||||||||||||    
T  47570281 tatccaaaagtcctagctcaactcacaaaatgtcaaaattgttaagccggatgtcataatcagggttcgaaccccggt 47570358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 309 - 369
Target Start/End: Complemental strand, 35208192 - 35208132
Alignment:
Q  309 ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||  ||||||| ||  ||||||| ||||||||||||||||||| ||||||||||    
T  35208192 ccagaagtctcagctcaagtgataaaatgctgaaattgttaggccggatgtcatgaccggg 35208132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 36518103 - 36518167
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcga 374  Q
    |||||||||||||||| |  ||||||||||||||| ||||| |||||||||| ||| ||||||||    
T  36518103 agaagtcctagctcaattaacaaaatgccgaaattattaggtcggatgccataaccagggttcga 36518167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 41377588 - 41377655
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||| ||||||| |||||||| | ||||| || |||||||||||    
T  41377588 agaagtcctagctcaactggc-aaatgccaaaattgtaaggccggacgtcatgatccaggttcgaaccc 41377655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 365
Target Start/End: Complemental strand, 46316600 - 46316548
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    |||||||| ||||||||  |||||||||||||||||||| |||||| ||||||    
T  46316600 aagtcctaactcaactgaaaaaatgccgaaattgttaggtcggatgtcatgac 46316548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 21569332 - 21569261
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||||||| || |||||||| ||||||| | ||||||||||| |||||| |||||||||  |||||||||||    
T  21569332 cagaagtcttaactcaactgacaaaatgacaaaattgttaggacggatgtcatgaccggtattcgaaccccg 21569261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 315 - 377
Target Start/End: Complemental strand, 25313047 - 25312984
Alignment:
Q  315 gtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaacc 377  Q
    ||||||||| |||||| |||||||| ||||||||||| |||||| ||| |||||| ||||||||    
T  25313047 gtcctagctgaactggtaaaatgccaaaattgttaggtcggatgtcataaccgggattcgaacc 25312984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 32956775 - 32956842
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||| |||||| || ||||||| |||||||||||||| || | ||||||| |||||||||||||    
T  32956775 aagtcctaactcaaccggtaaaatgctgaaattgttaggccagacgtcatgaccggggttcgaacccc 32956842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 305 - 364
Target Start/End: Original strand, 39172037 - 39172096
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    ||||| ||||||||||||  ||||||||||||| | |||||||||||||| ||| |||||    
T  39172037 atatcaagaagtcctagcataactggcaaaatgtcaaaattgttaggccgaatgtcatga 39172096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 48209535 - 48209484
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||| ||||||||||||||||| |||||||| |||| ||||||||||||||    
T  48209535 aaaataccgaaattgttaggccgaatgccatggccggagttcgaaccccggt 48209484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 367
Target Start/End: Original strand, 9318523 - 9318577
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    ||||| ||| ||||||||||||||| |||||||||||||| ||||| ||| ||||    
T  9318523 aagtcttagttcaactggcaaaatgtcgaaattgttaggctggatgtcataaccg 9318577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 18462086 - 18462012
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    ||||||||||| || |||||||||| |||||| ||||||| |||| ||||||| || || | |||||||||||||    
T  18462086 tatccagaagttctggctcaactggtaaaatgtcgaaattattagaccggatgtcaagatcggggttcgaacccc 18462012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 377
Target Start/End: Complemental strand, 27719244 - 27719174
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaacc 377  Q
    |||||||||| ||||||||| || |||||| ||||||||||| | |||||  ||||||||| |||||||||    
T  27719244 tccagaagtcatagctcaacgggtaaaatgtcgaaattgttaagtcggatatcatgaccggagttcgaacc 27719174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 29216811 - 29216881
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||| || ||||| ||| |||||| ||||||||||||||||||| | |||||||| |||| |||||||||    
T  29216811 aagtcttaactcaattggaaaaatgtcgaaattgttaggccggatactatgaccggagttcaaaccccggt 29216881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 365
Target Start/End: Complemental strand, 46800157 - 46800103
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||| |||| ||||| |||||||||||||||||||||||  |||||| ||||||    
T  46800157 agaagacctaactcaattggcaaaatgccgaaattgttagatcggatgtcatgac 46800103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 337 - 377
Target Start/End: Complemental strand, 2947819 - 2947778
Alignment:
Q  337 gccgaaattgttaggccggatgccatgacc-gggttcgaacc 377  Q
    |||||||||||||||||||||| ||||||| |||||||||||    
T  2947819 gccgaaattgttaggccggatgtcatgaccggggttcgaacc 2947778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 308 - 379
Target Start/End: Complemental strand, 10071645 - 10071572
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccat-gaccgggttcgaacccc 379  Q
    |||| ||||||||||||||||| ||||| || | |||||||||||| ||||||||| | | |||||||||||||    
T  10071645 tccacaagtcctagctcaactgacaaaaatgtcaaaattgttaggctggatgccatggtcggggttcgaacccc 10071572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 364
Target Start/End: Complemental strand, 21893375 - 21893322
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    ||||||||||||| |||||||||| || ||||||||||||| | |||| |||||    
T  21893375 agaagtcctagcttaactggcaaagtgtcgaaattgttaggtcagatgtcatga 21893322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 336 - 369
Target Start/End: Complemental strand, 34481892 - 34481859
Alignment:
Q  336 tgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||||| ||||||||||    
T  34481892 tgccgaaattgttaggccggatgacatgaccggg 34481859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 323 - 364
Target Start/End: Original strand, 43357235 - 43357276
Alignment:
Q  323 tcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||| |||||||||||| ||||||||| ||||    
T  43357235 tcaactggcaaaattccgaaattgttaagccggatgctatga 43357276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 316 - 380
Target Start/End: Original strand, 44791717 - 44791781
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||||||||||||||||||  |||||||||| ||||| | ||||| | ||||||||||||||    
T  44791717 tcctagctcaactggcaaaatgctaaaattgttagaccggacg-catgatcggggttcgaaccccg 44791781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 382
Target Start/End: Complemental strand, 5350015 - 5349971
Alignment:
Q  339 cgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||| |||||| | ||||||||||||||||    
T  5350015 cgaaattgttaggccggataccatgatcggggttcgaaccccggt 5349971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 323 - 382
Target Start/End: Complemental strand, 6419778 - 6419718
Alignment:
Q  323 tcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| ||| |||||| |||||||||||||||||||| ||||||| | ||||||||| ||||    
T  6419778 tcaattggtaaaatgtcgaaattgttaggccggatgtcatgaccagcgttcgaaccgcggt 6419718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 319 - 378
Target Start/End: Complemental strand, 36229110 - 36229051
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    |||||||||||||||| |||||||||||  |||||||| | ||||| ||||||||||||||    
T  36229110 tagctcaactggcaaa-tgccgaaattgcaaggccggacgtcatgatccgggttcgaaccc 36229051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 42392929 - 42392862
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  ||| |||| | ||||| ||||| ||||||||    
T  42392929 agaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcatgatccgggctcgaaccc 42392862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 351
Target Start/End: Original strand, 49285507 - 49285551
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttagg 351  Q
    |||||||||||||| ||| |||| ||||||| |||||||||||||    
T  49285507 atccagaagtcctaactccactgacaaaatgtcgaaattgttagg 49285551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 305 - 365
Target Start/End: Original strand, 54950032 - 54950092
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||||||||||| || |||||||| |||||| |  ||||||||||| ||| |||||||||    
T  54950032 atatccagaagtcttaactcaactgacaaaattctaaaattgttaggtcgggtgccatgac 54950092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 71; Significance: 5e-32; HSPs: 118)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 10635486 - 10635564
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  10635486 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 10635564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 19338309 - 19338231
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  19338309 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 19338231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 48391953 - 48392031
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  48391953 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggt 48392031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 29005088 - 29005165
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  29005088 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 29005165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 43676153 - 43676077
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  43676153 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 43676077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 40958705 - 40958627
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||    
T  40958705 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggt 40958627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 48314166 - 48314242
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  48314166 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 48314242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 42631115 - 42631040
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||    
T  42631115 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccg 42631040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 306 - 368
Target Start/End: Original strand, 28999372 - 28999434
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg 368  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28999372 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg 28999434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 270451 - 270374
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  270451 atccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 270374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 17068150 - 17068227
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  17068150 tatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgagcggggttcgaaccccggt 17068227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 49948240 - 49948313
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaacccc 379  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||    
T  49948240 atccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcgaacccc 49948313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 43086600 - 43086524
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  43086600 atccataagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 43086524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 304 - 382
Target Start/End: Complemental strand, 15906299 - 15906220
Alignment:
Q  304 catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| | ||||||||||||||||    
T  15906299 catatccagaagtcctagctcaactagcaaaatgccgaaattgttaggccagatgccatgatcagggttcgaaccccggt 15906220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 316 - 382
Target Start/End: Complemental strand, 20164193 - 20164126
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  20164193 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 20164126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 40809342 - 40809280
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  40809342 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggg 40809280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 3315796 - 3315869
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||    
T  3315796 cagaagtcctagctcaactggcaaaatgccgacattgttaggccggatgccatgaccaggattcgaaccccggt 3315869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 4126573 - 4126650
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| | ||||||||||||||||    
T  4126573 tatccagaagtcctagctcaactgacaaaatgcggaaattgttaggccggatgccatgatcagggttcgaaccccggt 4126650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 24119658 - 24119727
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  24119658 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc 24119727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 5598300 - 5598376
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||| ||||||||||||||    
T  5598300 atccagaagtcctagctcaactggaaaaatgccgaaattgttaggtcggatgtcatgaccggagttcgaaccccggt 5598376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 13555849 - 13555777
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||    
T  13555849 agaagtcctagctcaactggcaaaatgccgaaattattaggccggatgtcatgaccggggttcgaaccccggt 13555777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 380
Target Start/End: Complemental strand, 32880710 - 32880634
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg 380  Q
    ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||    
T  32880710 atatctagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccg 32880634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 48731881 - 48731809
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||||||    
T  48731881 agaagtcctagctcaactgacaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggt 48731809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 49500860 - 49500936
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||    
T  49500860 atccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcgaggttcgaaccccggt 49500936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 13018070 - 13018148
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| ||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||    
T  13018070 atatcaagaagtcttagctcaactggcaaagtgccgaaattgttagaccggatgccatgaccggggttcgaaccccggt 13018148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 15331185 - 15331115
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    |||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||    
T  15331185 aagtcctagctcaactggaaaaatgccgaaattgttaggtcggatgccatgaccgaggttcgaaccccggt 15331115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 11403171 - 11403244
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||| |||||||||||||||||||| |||||||||||| | ||||||||||||||||    
T  11403171 cagaagtcctagctcaactgggaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggt 11403244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 18475107 - 18475180
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| | ||||||||||||    
T  18475107 tatccagaagtcctagctcaactggcaaaataccgacattgttaggccggatgccatgatcggggttcgaaccc 18475180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 21522315 - 21522392
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| |||||||||||||||| ||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||    
T  21522315 tatctagaagtcctagctcaattggcaaagtgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggt 21522392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 34010092 - 34010169
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| | ||||| ||||||||||    
T  34010092 tatccagaagtcttagctcaactggcaaaatgtcgaaattgttaggccggatgccatgatcggggtttgaaccccggt 34010169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 41445156 - 41445083
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||| ||||||||||||||    
T  41445156 cagaagtcctagctcaactggcaaaatgccgacattgttaggccggatgtcatgatcggagttcgaaccccggt 41445083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 18089897 - 18089821
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| ||| ||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  18089897 atccagaagtcttagttcaactgacaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 18089821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 25821079 - 25821007
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||||  |||||| |||||||||||||||||||||||||||| ||||||||||||    
T  25821079 atccagaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc 25821007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 39606407 - 39606478
Alignment:
Q  311 agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||    
T  39606407 agaagtcctagctcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccg 39606478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 40685527 - 40685590
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||    
T  40685527 tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggg 40685590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 50248027 - 50248102
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg 380  Q
    ||||||||||||||||||||||||  |||||| |||||||||||||||||||| |||||||| |||||||||||||    
T  50248027 tatccagaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgtcatgaccgaggttcgaaccccg 50248102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 311 - 369
Target Start/End: Original strand, 5790061 - 5790119
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||    
T  5790061 agaagtcctagcttaactggcaaaatgccgaaattgttaggccggatgtcatgaccggg 5790119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 35010718 - 35010644
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||  || ||||||||||||    
T  35010718 atccagaagtcctagctcaactagcaaaatgccgaaattgttaggctggatgccatgattggagttcgaaccccg 35010644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 318 - 382
Target Start/End: Complemental strand, 33845722 - 33845657
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||    
T  33845722 ctagctcaactggcaaaatgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggt 33845657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 318 - 382
Target Start/End: Original strand, 33948256 - 33948321
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||    
T  33948256 ctagctcaactggcaaaatgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggt 33948321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 15104041 - 15104117
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    ||||| ||||||||||||||||||| ||||||||| |||||||||||||||||| ||||| | ||||||||||||||    
T  15104041 atatctagaagtcctagctcaactgacaaaatgccaaaattgttaggccggatgtcatgatcggggttcgaaccccg 15104117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 26261422 - 26261346
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||| | ||||||||| ||||||    
T  26261422 atccacaagtcctagctcaactggaaaaatgccgaaattgttaggccggataccatgatcggggttcgaatcccggt 26261346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 376
Target Start/End: Original strand, 43025883 - 43025955
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaac 376  Q
    ||||||||||||||||| ||||||| ||||||  |||||||||||||||||||||||||||| ||||||||||    
T  43025883 atatccagaagtcctagttcaactgacaaaatatcgaaattgttaggccggatgccatgacctgggttcgaac 43025955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 305 - 364
Target Start/End: Complemental strand, 19279983 - 19279924
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||    
T  19279983 atatccagaagtcctagctcaactggtaaaatgccgaaattgttaggtcggataccatga 19279924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 25083249 - 25083175
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||| ||||||||   |||||||||||||| | ||||||||||||||||    
T  25083249 tatccagaagtcctagctcaactggcaaaatgctgaaattgt---gccggatgccatgatcggggttcgaaccccggt 25083175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 305 - 364
Target Start/End: Original strand, 30455201 - 30455260
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||||||||||||||  |||||| ||||||||||||||||||||||||||    
T  30455201 atatccagaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgccatga 30455260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 39522884 - 39522811
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||||| ||||||||||||||||||||||| | | |||||||||| |||||    
T  39522884 cagaagtcctaactcaactggcaaaatgcagaaattgttaggccggatgccattatcggggttcgaactccggt 39522811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 39787780 - 39787703
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| |||||||||||||||||| |||||| |||||||||||| ||| ||||||||||| |||||||||| |||||    
T  39787780 tatccacaagtcctagctcaactggtaaaatgtcgaaattgttagaccgaatgccatgaccggggttcgaactccggt 39787703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 375
Target Start/End: Complemental strand, 3840487 - 3840423
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaa 375  Q
    ||||||||||||||||||||||||||| |||||||||||||| ||||| |||||  |||||||||    
T  3840487 agaagtcctagctcaactggcaaaatgtcgaaattgttaggctggatgtcatgatggggttcgaa 3840423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 27078548 - 27078623
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||| | |||||||||||| ||||||| |||||||||||||||||||| ||||||| ||||||||||||||||    
T  27078548 atccagaaattctagctcaactg-caaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 27078623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 309 - 380
Target Start/End: Original strand, 29511109 - 29511181
Alignment:
Q  309 ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||||||||||||||||| ||| |||||| |||||||||||||||| ||| ||||||| ||||||||||||||    
T  29511109 ccagaagtcctagctcaattggtaaaatgacgaaattgttaggccgaatgtcatgaccggggttcgaaccccg 29511181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 36586250 - 36586326
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||||| ||||||||| |||||| |||||||||||||||||||||| ||| | ||||||||||||||||    
T  36586250 atccacaagtcctaactcaactggtaaaatgtcgaaattgttaggccggatgccgtgatcggggttcgaaccccggt 36586326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 18216346 - 18216405
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||  || ||||||||||||||||||||||||||||||||| ||||    
T  18216346 cagaagtcctagctcaatgggtaaaatgccgaaattgttaggccggatgccatgatcggg 18216405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 40962828 - 40962757
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||||||||||||||| ||||||||| ||||| |||||| ||||||||||| | ||||||||||||||    
T  40962828 cagaagtcctagctcaactgacaaaatgccaaaattattaggctggatgccatgatcggggttcgaaccccg 40962757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 5322591 - 5322665
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||||||||| |||||||||||| |||||||| ||||||||||||| ||||  ||||||| ||||||||||||||    
T  5322591 atccagaagttctagctcaactgacaaaatgctgaaattgttaggctggatatcatgaccggggttcgaaccccg 5322665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 310 - 379
Target Start/End: Complemental strand, 8194088 - 8194018
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||||||||| |||||  ||||| |||||||||||||||| |||||||||||| |||||||||||||    
T  8194088 cagaagtcctagcttaactgataaaataccgaaattgttaggcctgatgccatgaccggggttcgaacccc 8194018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 8214622 - 8214684
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||| |||||  ||||||||||||||||||  |||||||||||    
T  8214622 atccagaagtcctagctcaactggaaaaatatcgaaattgttaggccggaccccatgaccggg 8214684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 366
Target Start/End: Complemental strand, 14971684 - 14971622
Alignment:
Q  305 atatccagaagtcctag-ctcaactggcaaaatgccgaaattgttaggccggatgccatgacc 366  Q
    ||||||||||||||||| |||||||||||||||||| ||||| |||||||||||| |||||||    
T  14971684 atatccagaagtcctaggctcaactggcaaaatgccaaaattattaggccggatgtcatgacc 14971622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 382 - 422
Target Start/End: Original strand, 6837956 - 6837996
Alignment:
Q  382 tgccatctccttggatttcaattgcagcaaaccttgatgat 422  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  6837956 tgccatctccttggatttcaattgcagcaaaccttgatgat 6837996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 313 - 369
Target Start/End: Complemental strand, 11797522 - 11797466
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||| |||||||||||||||| |||||||||||||||| ||| ||||||||||    
T  11797522 aagtcctaactcaactggcaaaatgtcgaaattgttaggccgaatgtcatgaccggg 11797466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 15952957 - 15952885
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||| ||||||||||||||||||||||||||||||||| ||||||  |||| | |||||||||| |||||    
T  15952957 agaagtcgtagctcaactggcaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaactccggt 15952885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 309 - 369
Target Start/End: Complemental strand, 22561294 - 22561234
Alignment:
Q  309 ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||| | |||||||||||| ||||||||||||||||||||||| ||| ||||    
T  22561294 ccagaagtcctagtttaactggcaaaataccgaaattgttaggccggatgccgtgatcggg 22561234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 377
Target Start/End: Complemental strand, 29510781 - 29510709
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacc 377  Q
    ||||||||||||||| |||||||| ||||||||| ||||||||||  |||||| ||||||| |||||||||||    
T  29510781 tatccagaagtcctaactcaactgtcaaaatgccaaaattgttagatcggatgtcatgaccggggttcgaacc 29510709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 362
Target Start/End: Original strand, 32533825 - 32533881
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccat 362  Q
    ||||||||||| |||| ||||||||||||||||| |||||||||||||| |||||||    
T  32533825 tatccagaagttctagttcaactggcaaaatgccaaaattgttaggccgaatgccat 32533881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 39467027 - 39467099
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||   ||||||||||||| ||||| |||| | ||||||||||||||||    
T  39467027 agaagtcctagctcaactggcaaaatggtaaaattgttaggccagatgctatgatcggggttcgaaccccggt 39467099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 46850963 - 46851039
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| ||||| ||| |||||| |||||||| ||||||||||||| |||||||||||| |||||||||||| |||||    
T  46850963 atccacaagtcatagttcaactagcaaaatgtcgaaattgttaggtcggatgccatgatccgggttcgaactccggt 46851039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 382
Target Start/End: Original strand, 9705547 - 9705602
Alignment:
Q  328 tggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||||||| |||||||||||||||||||||||||  ||||||||||||||||    
T  9705547 tggcaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggt 9705602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 313 - 378
Target Start/End: Complemental strand, 10430463 - 10430396
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccc 378  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||| |||||  ||||||||||||    
T  10430463 aagtcctagctcaactgacaaaaatgccgaaattgttaggccggatgcaatgactggggttcgaaccc 10430396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 305 - 379
Target Start/End: Complemental strand, 45007822 - 45007747
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacccc 379  Q
    ||||||| || ||||||||||| ||| |||||  |||||||||||||||||||| |||||||| ||||||||||||    
T  45007822 atatccaaaaatcctagctcaattggtaaaatatcgaaattgttaggccggatgtcatgaccgaggttcgaacccc 45007747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 49632553 - 49632628
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg 380  Q
    ||||| ||||||||| |||||||| |||| ||||||||||||||||| ||||| |||||||| |||||||||||||    
T  49632553 atccataagtcctagttcaactggtaaaaatgccgaaattgttaggctggatgtcatgaccgaggttcgaaccccg 49632628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 46561364 - 46561302
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||| |||| |||||| |||||||||| |||||||||| ||||||||||||| ||||    
T  46561364 atccagaagttctagttcaactagcaaaatgccaaaattgttagtccggatgccatgatcggg 46561302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 7204632 - 7204563
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||||||||||||||| ||||||||||||||||||| |   ||||||| ||||||||||||||    
T  7204632 aagtcctagctcaactggcaaaaatgccgaaattgttaggccgaacatcatgaccggggttcgaaccccg 7204563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 356
Target Start/End: Original strand, 14890286 - 14890335
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||||||||||||||| ||| |||||| |||||    
T  14890286 atccagaagtcctagctcaactggcaaaatgccaaaaatgttagaccgga 14890335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 21897807 - 21897734
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||||||||||| ||||||| |||||||||||||| |||||| |||| | |||||||||| |||||    
T  21897807 cagaaatcctagctcaactgacaaaatgtcgaaattgttaggctggatgctatgatcggggttcgaactccggt 21897734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 23225420 - 23225343
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||| |||| || | ||||||||||| |||||||||||||  ||||||||||||||||    
T  23225420 atccacaagtcctagctcaactggtaaaaatgtcaaaattgttaggtcggatgccatgacaggggttcgaaccccggt 23225343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 40503596 - 40503653
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||| |||||||||||| |||||||  ||||||||||||||||||| |||||    
T  40503596 atccagaagttctagctcaactgacaaaatgttgaaattgttaggccggatgtcatga 40503653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 330 - 382
Target Start/End: Complemental strand, 47429698 - 47429645
Alignment:
Q  330 gcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||| | ||||||||| ||||||    
T  47429698 gcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaatcccggt 47429645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 13048932 - 13048860
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||| |||||| |||||||| |||||  |||||||||||||||||||| ||||| ||| ||||||||||||||    
T  13048932 agaaatcctagttcaactggtaaaatatcgaaattgttaggccggatgtcatgatcggagttcgaaccccggt 13048860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 13053929 - 13053857
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||| |||||| |||||||| |||||  |||||||||||||||||||| ||||| ||| ||||||||||||||    
T  13053929 agaaatcctagttcaactggtaaaatatcgaaattgttaggccggatgtcatgatcggagttcgaaccccggt 13053857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 32007078 - 32007145
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  32007078 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 32007145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 41808206 - 41808273
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  41808206 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 41808273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 12282613 - 12282676
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||| ||||||||||| |||||||  ||| || |||||||||||||| ||||||||||||||||    
T  12282613 tatctagaagtcctagttcaactgataaagtgtcgaaattgttaggctggatgccatgaccggg 12282676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 23913617 - 23913680
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||| ||||||||| |||| ||| ||| |||||||||||| ||||| ||||||||||    
T  23913617 tatccagaagttctagctcaagtggctaaaagccaaaattgttaggctggatgtcatgaccggg 23913680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 314 - 382
Target Start/End: Original strand, 236575 - 236645
Alignment:
Q  314 agtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||| |||||||| ||||| || |||||||||||||||||| | ||||||| ||||||||||||||||    
T  236575 agtcctacctcaactgacaaaaatgtcgaaattgttaggccggacgtcatgaccggggttcgaaccccggt 236645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 40241493 - 40241563
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||| ||||||||  |||||| |||||||||||||||||||  ||||||||| ||||||||| ||||    
T  40241493 aagtcctaactcaactgataaaatgtcgaaattgttaggccggatatcatgaccggagttcgaacctcggt 40241563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 351
Target Start/End: Original strand, 41651078 - 41651116
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttagg 351  Q
    |||||||||||||||||| ||||||||||||||||||||    
T  41651078 aagtcctagctcaactggtaaaatgccgaaattgttagg 41651116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 17540200 - 17540131
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||||||||||||||| | |||| |||||||||||||||||| || | ||||||| ||||||||||||||    
T  17540200 aagtcctagctcaactagtaaaaatgccgaaattgttaggccagacgtcatgaccggggttcgaaccccg 17540131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 364
Target Start/End: Original strand, 21938946 - 21938998
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||||||||| ||| |||||||||||| |||||||||| |||||    
T  21938946 agaagtcctagctcaactggtaaa-tgccgaaattgtaaggccggatgtcatga 21938998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 27855995 - 27856072
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| || || ||||||||||||  ||||||||||||||||||||| |||| ||||| | ||||||||| ||||||    
T  27855995 tatccacaaatcttagctcaactggagaaatgccgaaattgttaggccagatgtcatgatcggggttcgaatcccggt 27856072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 334 - 382
Target Start/End: Complemental strand, 29803275 - 29803226
Alignment:
Q  334 aatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||| |||||||||| | ||||||||||||||||    
T  29803275 aatgccgaaattgttaggccagatgccatgatcggggttcgaaccccggt 29803226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 5055912 - 5055845
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||| ||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  5055912 agaagtcctagctcagctggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 5055845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 6669305 - 6669381
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    |||||||||||| |||||||| ||  |||||||  ||||| |||| ||||||  |||||||| ||||||||||||||    
T  6669305 tatccagaagtcttagctcaattgataaaatgctaaaattattagaccggatatcatgaccgagttcgaaccccggt 6669381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 363
Target Start/End: Original strand, 11786102 - 11786158
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatg 363  Q
    ||||| |||| ||||||||||||  ||||||| ||||||||||||||||||| ||||    
T  11786102 atccacaagttctagctcaactgataaaatgctgaaattgttaggccggatgtcatg 11786158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 356
Target Start/End: Original strand, 28381225 - 28381273
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    |||| ||||||||||||||||||| ||||| ||||||||||||| ||||    
T  28381225 tccataagtcctagctcaactggctaaatgtcgaaattgttaggacgga 28381273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 29587256 - 29587323
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | | ||||| ||||||||||||    
T  29587256 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgacctgggttcgaaccc 29587323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 29994507 - 29994440
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  ||||| || | ||||| ||||||||||||||    
T  29994507 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccagacgtcatgatccgggttcgaaccc 29994440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 31278571 - 31278499
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccc 378  Q
    ||||||||||||| ||||||||  |||||||| ||||| ||||||  ||||| |||||||| |||||||||||    
T  31278571 atccagaagtcctggctcaactaccaaaatgctgaaatagttaggttggatgtcatgaccgaggttcgaaccc 31278499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 353
Target Start/End: Complemental strand, 38886512 - 38886472
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggcc 353  Q
    |||||||||||||||||| ||||| ||||||||||||||||    
T  38886512 aagtcctagctcaactggtaaaataccgaaattgttaggcc 38886472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 369
Target Start/End: Complemental strand, 43500266 - 43500210
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||| |||||||||||| |||||| ||||||||||||| ||||||| |||| ||||    
T  43500266 aagtcttagctcaactggtaaaatgtcgaaattgttaggtcggatgctatgatcggg 43500210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 48660026 - 48660093
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| |  |||| ||||||||||||||    
T  48660026 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgttatgacccgggttcgaaccc 48660093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 308 - 378
Target Start/End: Original strand, 2112747 - 2112818
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||| |||||||||||||||| ||||||||  ||||| |||||| |||| | ||||||| ||||||||||||    
T  2112747 tccacaagtcctagctcaactagcaaaatgatgaaatcgttaggtcggacgtcatgaccggggttcgaaccc 2112818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 357
Target Start/End: Complemental strand, 15324583 - 15324532
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggat 357  Q
    |||||| ||||| ||||||||||| ||||||||||||||| ||||| |||||    
T  15324583 tatccacaagtcatagctcaactgacaaaatgccgaaattattaggtcggat 15324532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 336 - 382
Target Start/End: Original strand, 35758303 - 35758350
Alignment:
Q  336 tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||  |||||||||||| ||||||||||||||||    
T  35758303 tgccgaaattgttaggctcgatgccatgaccggggttcgaaccccggt 35758350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 316 - 378
Target Start/End: Original strand, 43837095 - 43837158
Alignment:
Q  316 tcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgggttcgaaccc 378  Q
    |||||||||||||||||||| || || |||||||||||||||||  |||||| ||||| |||||    
T  43837095 tcctagctcaactggcaaaaatgtcggaattgttaggccggatgttatgaccaggttcaaaccc 43837158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 311 - 380
Target Start/End: Complemental strand, 50145258 - 50145187
Alignment:
Q  311 agaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg 380  Q
    ||||||||||||||||| ||| |||||| | | |||||||||||||||| |||||| ||| |||||||||||    
T  50145258 agaagtcctagctcaaccggcaaaaatgtcaatattgttaggccggatgtcatgactgggattcgaaccccg 50145187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 369
Target Start/End: Original strand, 1576377 - 1576435
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||| || ||||||||| |||||||| |||||||| |  |||||||||||||||||    
T  1576377 agaagtcttaactcaactggaaaaatgccaaaattgtttgatcggatgccatgaccggg 1576435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 335 - 369
Target Start/End: Complemental strand, 16084334 - 16084300
Alignment:
Q  335 atgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||||||||| ||||    
T  16084334 atgccgaaattgttaggccggatgccatgatcggg 16084300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 378
Target Start/End: Original strand, 25376196 - 25376262
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||| ||||||  |||||| ||||||||||||| ||||||  ||||||| ||||||||||||    
T  25376196 aagtcctagttcaactatcaaaataccgaaattgttagaccggatttcatgaccggggttcgaaccc 25376262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 48302283 - 48302345
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||| ||||||||| |||||||   ||||||||||||||||| |||| || |||||||||||    
T  48302283 atccacaagtcctagttcaactgaggaaatgccgaaattgttaagccgaataccatgaccggg 48302345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 52492812 - 52492734
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| ||||| ||||||||| ||  ||||||  ||||||||||||||||||| |||||   ||||||||||||||||    
T  52492812 atatcctgaagttctagctcaattgataaaatgttgaaattgttaggccggatgtcatgattggggttcgaaccccggt 52492734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 423
Target Start/End: Original strand, 8976516 - 8976557
Alignment:
Q  382 tgccatctccttggatttcaattgcagcaaaccttgatgatg 423  Q
    |||||||||||||||||||||||| ||||  |||||||||||    
T  8976516 tgccatctccttggatttcaattggagcaggccttgatgatg 8976557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 308 - 376
Target Start/End: Complemental strand, 23810012 - 23809943
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaac 376  Q
    |||||||||||||  ||||| | ||||||  |||||||||||||||||||| ||||| ||| ||||||||    
T  23810012 tccagaagtcctaattcaacagacaaaatatcgaaattgttaggccggatgtcatgatcggagttcgaac 23809943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 28455878 - 28455922
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| ||||||||||||||  ||||||||    
T  28455878 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga 28455922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 36018881 - 36018939
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||| |||||    |||||| |||||||||||||||||||| ||||| ||||    
T  36018881 atccagaagtcctagttcaac----aaaatgtcgaaattgttaggccggatgtcatgatcggg 36018939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 376
Target Start/End: Complemental strand, 37186941 - 37186876
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaac 376  Q
    |||| ||||||||||||| |||| |||||||||||||| |||||| | ||||||| ||||||||||    
T  37186941 aagttctagctcaactggtaaaaatgccgaaattgttaagccggacgtcatgaccagggttcgaac 37186876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 316 - 357
Target Start/End: Original strand, 37771077 - 37771118
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggat 357  Q
    ||||||||||| ||| |||||| |||||||||||||||||||    
T  37771077 tcctagctcaattggtaaaatgtcgaaattgttaggccggat 37771118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 364
Target Start/End: Complemental strand, 16867516 - 16867464
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga 364  Q
    |||||||| |||||||||||||| ||||||||| |||||||| |||| |||||    
T  16867516 aagtcctaactcaactggcaaaaatgccgaaatcgttaggccagatgtcatga 16867464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 357
Target Start/End: Original strand, 28689591 - 28689634
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggat 357  Q
    |||||| ||||||||||||||| ||||||||||||||||| ||||    
T  28689591 aagtccaagctcaactggcaaa-tgccgaaattgttaggctggat 28689634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 70; Significance: 2e-31; HSPs: 84)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 8448272 - 8448195
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  8448272 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 8448195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 8457076 - 8456999
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  8457076 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 8456999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 305 - 385
Target Start/End: Complemental strand, 17534654 - 17534573
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||    
T  17534654 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtgcc 17534573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 16496783 - 16496702
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  16496783 tatccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc 16496702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 2314728 - 2314652
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  2314728 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 2314652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 305 - 379
Target Start/End: Complemental strand, 31205314 - 31205239
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  31205314 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaacccc 31205239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 735443 - 735520
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  735443 tatccagaagttctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 735520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 8939624 - 8939701
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||    
T  8939624 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 8939701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 310 - 378
Target Start/End: Complemental strand, 18861893 - 18861824
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  18861893 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc 18861824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 1241592 - 1241668
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||    
T  1241592 atattcagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccg 1241668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 4083586 - 4083662
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||    
T  4083586 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaacaccggt 4083662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 8329687 - 8329611
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||    
T  8329687 atccaaaagtcctagctcaactggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 8329611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 10263200 - 10263128
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||    
T  10263200 atccagaagtcctagctcaactggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccc 10263128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 380
Target Start/End: Complemental strand, 13507441 - 13507365
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||    
T  13507441 atatccagaagtcctagctcaactgggaaaatgccgaaattgttaggctggatgccatgaccggtgttcgaaccccg 13507365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 32643858 - 32643781
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||    
T  32643858 tatccagaagtcctaactcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggt 32643781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 4480471 - 4480547
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||    
T  4480471 atatccagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgattggggttcgaaccccg 4480547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 34287300 - 34287224
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||    
T  34287300 atccagaagtcatagttcaactggcaaaatgccgacattgttaggccggatgccatgaccggggttcgaaccccggt 34287224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 13540291 - 13540228
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||    
T  13540291 tatccagaagtcctagctcaaatggcaaaatgccgaaattgttaggccggatgcaatgaccggg 13540228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 310 - 379
Target Start/End: Original strand, 16244413 - 16244483
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||    
T  16244413 cagaagtcctagatcaactggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaacccc 16244483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 32107961 - 32107888
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| | ||||||||||||||||    
T  32107961 cagaagtcctagctcaactggcaaaatgccgaaattgttaggctggatgtcatgatcggggttcgaaccccggt 32107888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 1686363 - 1686287
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||  ||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  1686363 atccagaagtcgtagctcaactgctaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 1686287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 5603576 - 5603504
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||    
T  5603576 atccagaagttctagctcaactggaaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccc 5603504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 307 - 377
Target Start/End: Original strand, 7098805 - 7098876
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacc 377  Q
    |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||  |||||||||||    
T  7098805 atccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgactagggttcgaacc 7098876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 4996871 - 4996933
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||    
T  4996871 atccagaagtcctagctcaactgacaaaatgctgaaattgttaggccggatgccatgatcggg 4996933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 29183657 - 29183731
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||||||||||||||||||| ||| ||||| |||| |||||||||||||||||||||||| ||||||||||||||    
T  29183657 atccagaagtcctagctcaattggtaaaataccgacattgttaggccggatgccatgaccggggttcgaaccccg 29183731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 31747117 - 31747039
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||| ||||| || |||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  31747117 atattcagaaatcttagctcaactggtaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 31747039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 6266630 - 6266707
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||| |||||| ||||||||||||||||||| |||||||||||| ||||||| ||||||||| ||||||||||||||    
T  6266630 tatccggaagtcttagctcaactggcaaaatgtcgaaattgttagaccggatgtcatgaccggagttcgaaccccggt 6266707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 12795145 - 12795072
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||| ||||||||||| ||||    
T  12795145 cagaagtcctagctcaactagtaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccgcggt 12795072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 15953232 - 15953309
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||| |||  |||||| ||||||||||||||||    
T  15953232 tatccagaagtcctagctcaactggtaaaatgccgaaattgttagaccgaatgtaatgaccggggttcgaaccccggt 15953309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 27866587 - 27866660
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    |||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||| | |||||||||||||    
T  27866587 atccagaagtcccagctcaattggcaaaatgccaaaattgttaggccggatgccatgatcggggttcgaacccc 27866660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 28594201 - 28594124
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||| | ||||||||||| ||||    
T  28594201 tatccagaagtcctaactcaactggcaaaaggtcgaaattgttaggccggatgccatgatcggggttcgaacctcggt 28594124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 31444420 - 31444343
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||||  ||||||||||||||||    
T  31444420 atccagaagtcctagctcaaccggcaaaaatgccgaaattgttaggccgggtgccatgactggggttcgaaccccggt 31444343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 10181044 - 10181116
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||| | ||||||||||||    
T  10181044 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcgtgatcggggttcgaaccc 10181116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 4891007 - 4891069
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||| |||||||||||| |||||||||||||||||||||| |||| ||||||||||    
T  4891007 atccagaagtcttagctcaactggaaaaatgccgaaattgttaggccagatgtcatgaccggg 4891069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 10330802 - 10330880
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| ||||||||||||||||||||||| |||| ||||||||||||| |||||||||||| ||| ||||||||||||    
T  10330802 tatccacaagtcctagctcaactggcaaaaatgccaaaattgttaggccagatgccatgaccggggatcgaaccccggt 10330880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 11242727 - 11242653
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacccc 379  Q
    |||||||||||||||||||||||   |||||||||||||||||||| |||||||||||||  |||||||||||||    
T  11242727 tatccagaagtcctagctcaactaataaaatgccgaaattgttaggacggatgccatgactggggttcgaacccc 11242653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 21513074 - 21513128
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||| |||||    
T  21513074 cagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatga 21513128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 34830783 - 34830853
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||||||||||||  |||||||||||||||||||| |||||||||||||||| ||||||| ||||||    
T  34830783 aagtcctagctcaactgataaaatgccgaaattgttaggtcggatgccatgaccggagttcgaagcccggt 34830853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 31057830 - 31057907
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||| ||||||||||||| |||||| || ||||||| |||||||| ||||||| ||||||||||||||||    
T  31057830 tatccagaagtcatagctcaactggcgaaatgctgacattgttaagccggatgtcatgaccggggttcgaaccccggt 31057907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 2301504 - 2301432
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| |||||||||||||||||||||||| ||||||||||| |||||| ||| ||| ||||||||||||||||    
T  2301504 agaaatcctagctcaactggcaaaatgccaaaattgttaggtcggatgtcataaccggggttcgaaccccggt 2301432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 323 - 382
Target Start/End: Original strand, 2959008 - 2959068
Alignment:
Q  323 tcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  2959008 tcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt 2959068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 8374141 - 8374213
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    |||||||||| ||| ||||||||| ||||||||||||||||||||| ||||||||||| | ||||||||||||    
T  8374141 atccagaagttctaactcaactggtaaaatgccgaaattgttaggcgggatgccatgatcggggttcgaaccc 8374213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10531385 - 10531461
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||| |||||||||||| ||||||  ||||||||||||||||||||| |||| | ||||||||||||||||    
T  10531385 atccagaagttctagctcaactgacaaaatatcgaaattgttaggccggatgctatgatcggggttcgaaccccggt 10531461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 14982783 - 14982711
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccc 378  Q
    ||||| ||||||||||| ||||| |||||| ||||||||||||||||||||||||| |||| |||||||||||    
T  14982783 atccacaagtcctagcttaactgccaaaataccgaaattgttaggccggatgccataaccgaggttcgaaccc 14982711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 8116876 - 8116801
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||||| ||||||||||| ||||||||||||  |||||||||||||||||||||| ||| ||| ||||||||||||    
T  8116876 tatccacaagtcctagcttaactggcaaaatatcgaaattgttaggccggatgccgtgatcggagttcgaaccccg 8116801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 7098962 - 7099024
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||| || ||||||||||||||| |||||||||||||||||||||||| |||||||| ||||    
T  7098962 atccacaactcctagctcaactggaaaaatgccgaaattgttaggccgggtgccatgatcggg 7099024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 311 - 380
Target Start/End: Complemental strand, 24571742 - 24571672
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||||||||||||||||||  |||||| ||||||||||||||| |||| ||||||| ||||||||||||||    
T  24571742 agaagtcctagctcaactgaaaaaatgtcgaaattgttaggccagatgtcatgaccagggttcgaaccccg 24571672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 4128945 - 4129002
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||||||||||||||||||||| ||||| ||||||||||||||||||| ||| ||||    
T  4128945 tccagaagtcctagctcaactggtaaaataccgaaattgttaggccggacgccttgac 4129002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 8977153 - 8977230
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| ||||| ||||||||||||||||| |||| |||||||||||||||||| ||||| | ||||||||||||||||    
T  8977153 atccacaagtcttagctcaactggcaaaaatgcccaaattgttaggccggatgtcatgatcggggttcgaaccccggt 8977230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 319 - 382
Target Start/End: Complemental strand, 9949269 - 9949204
Alignment:
Q  319 tagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||| |||| ||||||||||||||||||||||||||||| | ||||||||||||||||    
T  9949269 tagctcaactggtaaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 9949204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 28322936 - 28323003
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||| |||||||| | ||||| ||||||||||||||    
T  28322936 agaagtcctagctcaactggc-aaatgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc 28323003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 365
Target Start/End: Complemental strand, 30615043 - 30614983
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    |||| |||||||||||| |||| |||||||||| |||||||||||||| ||||||||||||    
T  30615043 atattcagaagtcctagttcaattggcaaaatgtcgaaattgttaggctggatgccatgac 30614983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 2395683 - 2395624
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||| |||||| |||||||  ||||||||||||| |||||||||||||||||    
T  2395683 cagaagtcctaggtcaactagcaaaataacgaaattgttaggtcggatgccatgaccggg 2395624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 29479427 - 29479502
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg 380  Q
    |||||| || ||||| |||||||||||||||| |||||||||||||| ||||| ||| |||||| |||||||||||    
T  29479427 tatccataactcctaactcaactggcaaaatgtcgaaattgttaggctggatgtcataaccgggattcgaaccccg 29479502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 311 - 385
Target Start/End: Original strand, 34762671 - 34762746
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggtgcc 385  Q
    |||||| ||||||||||||  ||||| |||||||| |||||||||| ||||||| | |||||||||||||||||||    
T  34762671 agaagttctagctcaactgataaaatcccgaaattattaggccggacgccatgatcggggttcgaaccccggtgcc 34762746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 2746454 - 2746524
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||| |||||| | ||||||| |||||||||||||||||||| ||||||  ||||||||||||||||    
T  2746454 aagtcctatctcaaccgacaaaatgtcgaaattgttaggccggatgtcatgacaggggttcgaaccccggt 2746524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 6556606 - 6556536
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||| ||||||||| ||| |||||||||||||||||||||||||| | |||| | ||||||||||||||||    
T  6556606 aagttctagctcaattggtaaaatgccgaaattgttaggccggattctatgatcggggttcgaaccccggt 6556536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 1855008 - 1855081
Alignment:
Q  311 agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| | ||||||||||| || ||| |||||||||||||||||||||| | ||||||||||||||||    
T  1855008 agaagtcctagtttaactggcaaaaatgtcgatattgttaggccggatgccatgatcggggttcgaaccccggt 1855081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 2236236 - 2236309
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||| |||||||||||||| ||||||||||||||| |||||||||||| ||| ||  |||||||||| |||||    
T  2236236 cagaattcctagctcaactgacaaaatgccgaaattattaggccggatgtcataactggggttcgaactccggt 2236309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 5626190 - 5626113
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||| |||| ||||||||||||||| ||||||||||||||||||||  | ||| ||||||  ||||||||||||||||    
T  5626190 tatctagaaatcctagctcaactggaaaaatgccgaaattgttaggtagtatgtcatgactggggttcgaaccccggt 5626113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 310 - 359
Target Start/End: Complemental strand, 8487679 - 8487630
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgc 359  Q
    |||||||| |||||||||||| ||||||||||||||||||||||| ||||    
T  8487679 cagaagtcttagctcaactggtaaaatgccgaaattgttaggccgaatgc 8487630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 348
Target Start/End: Original strand, 26269248 - 26269285
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgtt 348  Q
    ||||||||||||||||||||||||||||||||||||||    
T  26269248 agaagtcctagctcaactggcaaaatgccgaaattgtt 26269285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 379
Target Start/End: Original strand, 2711304 - 2711376
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaacccc 379  Q
    ||||||||||||| ||||||||| ||||| |||||||||||||| |||| ||| |||| || |||||||||||    
T  2711304 tccagaagtcctaactcaactggtaaaataccgaaattgttaggtcggacgccttgacgggagttcgaacccc 2711376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 6453760 - 6453684
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||||||||| |||||||  ||||||||||||||||| ||||| |||| ||||||  |||| |||||||||||    
T  6453760 atccagaagtcctaactcaactaacaaaatgccgaaattgtcaggcctgatgtcatgactagggtccgaaccccggt 6453684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 33621498 - 33621565
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  33621498 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 33621565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 33704220 - 33704287
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  33704220 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 33704287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 382
Target Start/End: Original strand, 5660427 - 5660474
Alignment:
Q  336 tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||| | ||||||||||||||||    
T  5660427 tgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 5660474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 304 - 382
Target Start/End: Complemental strand, 23383188 - 23383109
Alignment:
Q  304 catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||||||||| |||||| ||||||||| |||||||||||| | |||| ||| | | ||||||||||||||||    
T  23383188 catattcagaagtcctagttcaactagcaaaatgctgaaattgttaggtcagatgtcataatcggggttcgaaccccggt 23383109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 31063076 - 31063001
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg 380  Q
    ||||||||||||||| |||||||   ||| |||||||||||||||||||||||| ||||  ||| |||||||||||    
T  31063076 tatccagaagtcctacctcaactaataaagtgccgaaattgttaggccggatgctatgattgggattcgaaccccg 31063001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 365
Target Start/End: Complemental strand, 8795526 - 8795480
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    |||||||||||| |||||||||||||||||||||||| || ||||||    
T  8795526 tagctcaactggaaaaatgccgaaattgttaggccgggtgtcatgac 8795480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 305 - 376
Target Start/End: Complemental strand, 2018894 - 2018821
Alignment:
Q  305 atatccagaagtcctagctcaactgg-caaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaac 376  Q
    ||||||||||||||||||||||||||  |||||| ||||||||||||| |  ||| |||||||| |||||||||    
T  2018894 atatccagaagtcctagctcaactggtaaaaatgtcgaaattgttaggtcaaatgtcatgaccgtggttcgaac 2018821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 322 - 382
Target Start/End: Original strand, 11152531 - 11152592
Alignment:
Q  322 ctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||| | ||||||| ||||||||| |||||||||||||||| ||||||||| ||||||    
T  11152531 ctcaactgaccaaatgccaaaattgttaagccggatgccatgaccggggttcgaatcccggt 11152592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 385
Target Start/End: Original strand, 11548231 - 11548308
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggtgcc 385  Q
    |||| |||| |||||| |||||| |||||  ||||||||||||||||||  | ||||||||||||||| |||| ||||    
T  11548231 tccaaaagttctagctgaactggtaaaattacgaaattgttaggccggaccctatgaccgggttcgaatcccgatgcc 11548308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 356
Target Start/End: Complemental strand, 7974836 - 7974788
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    |||| |||||||| |||||||| ||||||||||||||||||||| ||||    
T  7974836 tccacaagtcctacctcaactgacaaaatgccgaaattgttaggtcgga 7974788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 9727499 - 9727567
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    ||||||||| ||||||| ||||| || ||||||||||||||||||| |||||| | |||||||||||||    
T  9727499 aagtcctagttcaactgacaaaaatgtcgaaattgttaggccggataccatgatcggggttcgaacccc 9727567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 380
Target Start/End: Original strand, 17546041 - 17546109
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||||||||||||| || ||||||| ||||||||||||| |||||| ||||| ||| ||| ||||||||    
T  17546041 aagtcctagctcaattgacaaaatgtcgaaattgttaggtcggatgtcatgatcggagtttgaaccccg 17546109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 21000696 - 21000763
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||| | | ||||||| ||||||||||||    
T  21000696 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgtacgtcatgacctgggttcgaaccc 21000763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 368
Target Start/End: Complemental strand, 10319010 - 10318955
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg 368  Q
    ||||||||| ||||| | ||||||| |||||||||||||  |||||||||||||||    
T  10319010 aagtcctagttcaacagacaaaatgtcgaaattgttaggttggatgccatgaccgg 10318955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 382
Target Start/End: Complemental strand, 35164703 - 35164660
Alignment:
Q  340 gaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||| |||||||||| |||||    
T  35164703 gaaattgttaggccggatgccatgaccggggttcgaacaccggt 35164660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 314 - 364
Target Start/End: Original strand, 10673252 - 10673302
Alignment:
Q  314 agtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||| || ||||||||||||||||||| ||| ||| |||||    
T  10673252 agtcctagctcaaccggtaaaatgccgaaattgttagaccgaatgtcatga 10673302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 309 - 369
Target Start/End: Complemental strand, 1266870 - 1266809
Alignment:
Q  309 ccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||| |||||| || |||| ||||||||||||||||||||| | ||||| ||||    
T  1266870 ccagaagtcctaactcaaccggtaaaaatgccgaaattgttaggccggacgtcatgatcggg 1266809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 354
Target Start/End: Complemental strand, 31340603 - 31340562
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccg 354  Q
    |||||||| |||||||| ||| ||||||||||||||||||||    
T  31340603 aagtcctaactcaactgacaatatgccgaaattgttaggccg 31340562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 310 - 367
Target Start/End: Complemental strand, 34182579 - 34182522
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    ||||| ||||| |||| ||||||||||||||||||| ||||| |||||| ||| ||||    
T  34182579 cagaaatcctaactcagctggcaaaatgccgaaattattaggtcggatgtcataaccg 34182522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 306 - 358
Target Start/End: Original strand, 15640515 - 15640567
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    |||||||||||| |||||||||||| ||||||   ||||||||||| ||||||    
T  15640515 tatccagaagtcatagctcaactggtaaaatgttaaaattgttaggtcggatg 15640567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 69; Significance: 8e-31; HSPs: 122)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 48612516 - 48612592
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  48612516 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 48612592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 35157215 - 35157137
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  35157215 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 35157137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 1573971 - 1573894
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  1573971 tatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 1573894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 3497647 - 3497574
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  3497647 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc 3497574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 4106552 - 4106629
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  4106552 tatccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 4106629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 4887643 - 4887570
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccc 378  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  4887643 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccc 4887570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 35849293 - 35849370
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  35849293 tatccagaagtcctagctcaactggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 35849370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 19306711 - 19306787
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||    
T  19306711 atccagaagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccccggt 19306787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 2354927 - 2354852
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||    
T  2354927 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccccg 2354852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 45236928 - 45237003
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||    
T  45236928 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccg 45237003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 4069247 - 4069169
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||    
T  4069247 atatccagaagtcctaactcaactggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 4069169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 308 - 385
Target Start/End: Complemental strand, 6384646 - 6384569
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggtgcc 385  Q
    ||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||| |||||||||||||||||||    
T  6384646 tccagaagtcctagctcaactggtaaaataccgaaattgttaggccggacgccatgacggggttcgaaccccggtgcc 6384569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 17895632 - 17895709
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
T  17895632 tatcctgaagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggt 17895709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 47584801 - 47584724
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||    
T  47584801 tatccagaagtcctagctcaactggcaaaatgtcgacattgttaggccggatgccatgaccggggttcgaaccccggt 47584724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 369
Target Start/End: Original strand, 6596539 - 6596603
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  6596539 atatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggg 6596603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 10061145 - 10061069
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||    
T  10061145 atccacaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggt 10061069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 31717296 - 31717372
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||    
T  31717296 atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggt 31717372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 308 - 382
Target Start/End: Complemental strand, 27396442 - 27396367
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||    
T  27396442 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgattggggttcgaaccccggt 27396367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 40013260 - 40013339
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||    
T  40013260 atatccagaagtcctagctcaactgacaaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggt 40013339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 9379989 - 9380063
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||    
T  9379989 tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaacccc 9380063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 21226070 - 21226140
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  21226070 aagtcctatctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 21226140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 7312579 - 7312506
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||    
T  7312579 cagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggt 7312506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 311 - 376
Target Start/End: Original strand, 10166873 - 10166938
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaac 376  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||    
T  10166873 agaagtcctagctcaactgataaaatgccgaaattgttaggccggatgccatgaccgggttcgaac 10166938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 29151581 - 29151658
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| | ||||||||||||||||    
T  29151581 tatccagaagtcctagctcaactggcaaaatgctgaaattgttaggccggatgctatgatcggggttcgaaccccggt 29151658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 33228698 - 33228775
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||    
T  33228698 atccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggccggatgccatgaccgaggttcgaaccccggt 33228775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 1323682 - 1323754
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||    
T  1323682 atccagaagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccc 1323754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 5508696 - 5508760
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  5508696 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 5508760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 40809044 - 40809116
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||    
T  40809044 atccagaagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccc 40809116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 45041862 - 45041786
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||    
T  45041862 atccagaagtcttagctcaactggcaaaatgccgaaattgttaggtcggatgccttgaccggggttcgaaccccggt 45041786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 378
Target Start/End: Original strand, 18944921 - 18944995
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||  ||||||| ||||||||||||    
T  18944921 atatccagaagtcctagttcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccc 18944995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 19258426 - 19258499
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||| |||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  19258426 cagaagtcctggctcaactagaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 19258499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 40656241 - 40656161
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||||||||||  |||||| |||||||||||||||||||||||| ||||||||||||||||    
T  40656241 atatctagaagtcctagctcaactggcaaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccggt 40656161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 364
Target Start/End: Complemental strand, 48729813 - 48729756
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  48729813 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatga 48729756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 2228209 - 2228133
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||| ||||||    
T  2228209 atccagaagtcgtagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggt 2228133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6327210 - 6327286
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||| |||||||| ||||||||  |||||||||||||||||||||||||| ||||||||||||||||    
T  6327210 atccagaagtcctaactcaactgacaaaatgcaaaaattgttaggccggatgccatgaccggggttcgaaccccggt 6327286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 31300126 - 31300050
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||| ||||||||||| ||||    
T  31300126 atccagaagtcctagctaaactggcaaaatgccgaaattgttaagccggatgtcatgaccggggttcgaacctcggt 31300050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 33628027 - 33628099
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||| ||||||||||||    
T  33628027 atccagaagtcctagctcaactgacaaagtgccgaaattgttaagccggatgccatgaccagggttcgaaccc 33628099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 367
Target Start/End: Original strand, 46416548 - 46416608
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||    
T  46416548 atccagaagtcctaggtcaactggcaaaatgccgacattgttaggccggatgccatgaccg 46416608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 47182802 - 47182878
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||| | ||||||||||||||||    
T  47182802 atccataagtcctagctcaactggcaaaatgccaaaattgttagaccggatgccatgatcagggttcgaaccccggt 47182878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 2286222 - 2286148
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||| ||||||||||||||||| ||||||||| |||||||||||||||||||||||||| | ||||||||||||    
T  2286222 atccaaaagtcctagctcaactgacaaaatgccaaaattgttaggccggatgccatgaccagagttcgaaccccg 2286148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 317 - 382
Target Start/End: Original strand, 16816700 - 16816766
Alignment:
Q  317 cctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||    
T  16816700 cctagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccgcggt 16816766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 32251464 - 32251390
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||||||| ||||||||||||||||||||||||||| | |||||| ||||||| ||||||||||||||    
T  32251464 atccagaagtcctagttcaactggcaaaatgccgaaattgttaagtcggatgtcatgaccggggttcgaaccccg 32251390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 34708671 - 34708749
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| ||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||| ||||||||||||||||    
T  34708671 tatctagaagtcctagctcaactggcaaaaatgccgatattgttaggctggatgccatgaccggggttcgaaccccggt 34708749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 42557631 - 42557569
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||    
T  42557631 atccataagtcctagctcaattggcaaaatgccgaaattgttaggccggatgccatgatcggg 42557569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 1869818 - 1869891
Alignment:
Q  311 agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||| |||||    
T  1869818 agaagtcctagctcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaactccggt 1869891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 37410832 - 37410759
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccc 378  Q
    |||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||  ||||||||||||    
T  37410832 tatctagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgactggggttcgaaccc 37410759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 310 - 367
Target Start/End: Original strand, 38261003 - 38261060
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
T  38261003 cagaagtcctagctcaactgacaaaatgtcgaaattgttaggccggatgccatgaccg 38261060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 40857470 - 40857393
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||| ||| |||||| ||||||||||||| |||||||||||| | ||||||||||||||||    
T  40857470 tatccagaagtcctagctcaaatggtaaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggt 40857393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 3861465 - 3861389
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||| | ||||||||||||| |||||||||||||||||||| ||||| | ||||||||||||||||    
T  3861465 atccagaagtcctagtttaactggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggt 3861389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 325 - 382
Target Start/End: Complemental strand, 1582727 - 1582669
Alignment:
Q  325 aactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||    
T  1582727 aactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggt 1582669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 13769746 - 13769676
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||||||||||| ||||||||||||||||||||| |||||||  ||||||||||| |||||||||||||    
T  13769746 aagtcctagctcaattggcaaaatgccgaaattgttgggccggactccatgaccgggattcgaaccccggt 13769676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 26794909 - 26794987
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||| ||||||||||||||| ||||||||||| ||||||||||  |||||||||||||| |||||||||| |||||    
T  26794909 atatccacaagtcctagctcaaccggcaaaatgccaaaattgttagatcggatgccatgaccggggttcgaactccggt 26794987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 29628515 - 29628437
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||||| |||||||||||||| ||||| |||||||||||| | ||||||||| ||||||    
T  29628515 atatctagaagtcctagctcaactggaaaaatgccgaaattattaggtcggatgccatgatcagggttcgaatcccggt 29628437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 313 - 359
Target Start/End: Original strand, 33512802 - 33512848
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgc 359  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  33512802 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgc 33512848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 368
Target Start/End: Original strand, 44327638 - 44327700
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg 368  Q
    ||||||||| |||||||||||||||||||||| | |||||||||||||||||| |||||||||    
T  44327638 tatccagaattcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgaccgg 44327700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 4674435 - 4674362
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||| | | |||  ||||||| ||||||||||||||||    
T  4674435 cagaagtcctagctcaactggcaaaatgccgaaattgttaagtcagatatcatgaccggggttcgaaccccggt 4674362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 23789539 - 23789470
Alignment:
Q  311 agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||    
T  23789539 agaagtcctagttcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccc 23789470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10422477 - 10422553
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||||||  ||||||||||||| |||||||||||| | ||||||||| ||||||    
T  10422477 atccagaagtcttagctcaactggcaaaatatcgaaattgttaggtcggatgccatgatcggggttcgaatcccggt 10422553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 385
Target Start/End: Complemental strand, 12014858 - 12014782
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    ||||||||||| ||||||||| ||||| |||||||||||||||| || ||| ||||| |||||||||||||||||||    
T  12014858 cagaagtcctaactcaactggtaaaataccgaaattgttaggccagacgccttgaccggggttcgaaccccggtgcc 12014782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 37919972 - 37920044
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||  ||||||||||||| | |||||||||||| || |||||||||||||    
T  37919972 agaagtcctagctcaactggcaaaatatcgaaattgttaggtcagatgccatgacctggattcgaaccccggt 37920044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 8946452 - 8946503
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  8946452 aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 8946503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 306 - 369
Target Start/End: Complemental strand, 37117975 - 37117912
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||| |||||||  |||||||||||| |||||||||||| ||||    
T  37117975 tatccagaagtcctagctcaactgacaaaatgttgaaattgttaggtcggatgccatgatcggg 37117912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 312 - 382
Target Start/End: Original strand, 40873190 - 40873261
Alignment:
Q  312 gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| ||||||||||| || |||||||||||||| |||||| ||||||||||||| ||||||||||||||||    
T  40873190 gaagacctagctcaaccggtaaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggt 40873261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 46021555 - 46021484
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||  |||| ||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  46021555 aagtcctagctcaactgataaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 46021484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 48467810 - 48467881
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc 378  Q
    |||||||| |||||||||||||||||||||  |||||||||||| |||||||  ||||| ||||||||||||    
T  48467810 atccagaaatcctagctcaactggcaaaatatcgaaattgttagaccggatgttatgacggggttcgaaccc 48467881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 378
Target Start/End: Original strand, 41780260 - 41780334
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||| ||||||| |||||||| |||||||||||||  ||||| ||||||| ||||||||||||    
T  41780260 atatccagaagtcctaactcaactagcaaaatgtcgaaattgttaggttggatgtcatgaccggggttcgaaccc 41780334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 43188528 - 43188602
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaacccc 379  Q
    |||||||||| ||||||||| |||||||| ||||||||||||||||||| ||||||||||  |||||||||||||    
T  43188528 atccagaagtactagctcaagtggcaaaaatgccgaaattgttaggccgcatgccatgactagggttcgaacccc 43188602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 45946707 - 45946785
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||||| ||||||||||||||||| ||||||||| ||||| |||||||||||||||| || || ||||||||| ||||    
T  45946707 atatccaaaagtcctagctcaactgacaaaatgccaaaattattaggccggatgccattactggagttcgaacctcggt 45946785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 47086431 - 47086357
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    |||||| ||||||||||||||||| ||||| || |||||||||||||||||||||||||| | ||||||||||||    
T  47086431 tatccataagtcctagctcaactgacaaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccc 47086357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 4227336 - 4227409
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||| ||||| || ||||| |||||||||||||| |||||||||||| | ||||||||||||||||    
T  4227336 cagaagtcctagatcaaccggtaaaataccgaaattgttaggtcggatgccatgatcggggttcgaaccccggt 4227409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 43416413 - 43416340
Alignment:
Q  311 agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| ||| |||||||||||||| |||||| ||||||||||||||| |||||||| ||||||||||||||||    
T  43416413 agaagttctaactcaactggcaaaaatgccgatattgttaggccggataccatgaccggggttcgaaccccggt 43416340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 31770656 - 31770589
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||||| ||||| ||||||||||||||    
T  31770656 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggatgtcatgacccgggttcgaaccc 31770589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 349
Target Start/End: Complemental strand, 36280056 - 36280012
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgtta 349  Q
    ||||| |||||||||||||||||||||||||||||||||||||||    
T  36280056 atatctagaagtcctagctcaactggcaaaatgccgaaattgtta 36280012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 41862786 - 41862862
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||| | || |||||||||| ||||||||||||| |||||| ||| ||| ||||||||||||||||    
T  41862786 atccagaagtcctagtttaattggcaaaatgtcgaaattgttaggtcggatgtcataaccggggttcgaaccccggt 41862862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 43723311 - 43723387
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||||||||| |||||||||||||| ||||||||| |||||||| |||||   ||||||||||||||||    
T  43723311 atccacaagtcctagctcgactggcaaaatgccaaaattgttaagccggatgtcatgattggggttcgaaccccggt 43723387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 367
Target Start/End: Original strand, 47459415 - 47459475
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    ||||| ||||| |||||||||||| |||||| |||||||||||||||||||| ||||||||    
T  47459415 atccaaaagtcatagctcaactggtaaaatgtcgaaattgttaggccggatgtcatgaccg 47459475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 305 - 352
Target Start/End: Complemental strand, 788977 - 788930
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggc 352  Q
    ||||||||||| ||||||||||||| ||||||||||||||||||||||    
T  788977 atatccagaagccctagctcaactgacaaaatgccgaaattgttaggc 788930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 318 - 369
Target Start/End: Complemental strand, 10084417 - 10084366
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||| | |||||||||||||||||| |||||||||||||||||||    
T  10084417 ctagctcaactagaaaaatgccgaaattgttaagccggatgccatgaccggg 10084366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 19563221 - 19563162
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||| ||||||||||| | |||||||||||||||||||| |||||||||||| ||||    
T  19563221 cagaagttctagctcaactagtaaaatgccgaaattgttaggtcggatgccatgatcggg 19563162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 306 - 379
Target Start/End: Complemental strand, 5222703 - 5222629
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    ||||||||||||||| ||||||||| |||||||||||||||||| |  ||||| ||||| | |||||||||||||    
T  5222703 tatccagaagtcctaactcaactggtaaaatgccgaaattgttaagttggatgtcatgatcggggttcgaacccc 5222629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 308 - 382
Target Start/End: Complemental strand, 9234377 - 9234300
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||| |||||||||||||||||| ||||  ||||||||||||||||||||| || |||||||| ||||||| ||||||    
T  9234377 tccacaagtcctagctcaactggaaaaaaatgccgaaattgttaggccggacgctatgaccggagttcgaatcccggt 9234300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 316 - 354
Target Start/End: Complemental strand, 10704011 - 10703973
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccg 354  Q
    |||||||||||||||||||||||||||||||||||||||    
T  10704011 tcctagctcaactggcaaaatgccgaaattgttaggccg 10703973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 46274945 - 46275023
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| |||| |||||||||| || |||| |||||||||||||||| |||||||||||||| ||||||||| ||||||    
T  46274945 tatccataagttctagctcaaccggtaaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaatcccggt 46275023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 378
Target Start/End: Original strand, 14817437 - 14817498
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||| |||||| | |||||||||||||||||||||||| | ||||||||||||    
T  14817437 ctagctcaactgggaaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccc 14817498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 378
Target Start/End: Original strand, 15264433 - 15264494
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||| |||||| | |||||||||||||||||||||||| | ||||||||||||    
T  15264433 ctagctcaactgggaaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccc 15264494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 367
Target Start/End: Original strand, 20350260 - 20350321
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    ||||||||||||||| ||||| ||||||||||||||||||||||| ||  |||| |||||||    
T  20350260 tatccagaagtcctaactcaattggcaaaatgccgaaattgttagaccaaatgctatgaccg 20350321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 313 - 378
Target Start/End: Complemental strand, 26336502 - 26336437
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc 378  Q
    |||| ||||||||||||| ||||||  |||||||||| || ||||| |||||||||||||||||||    
T  26336502 aagttctagctcaactggtaaaatggtgaaattgttaagctggatgtcatgaccgggttcgaaccc 26336437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 364
Target Start/End: Original strand, 6369533 - 6369584
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||| ||| ||||||||| ||||||||||||||||||||||||||| |||||    
T  6369533 aagttctaactcaactggtaaaatgccgaaattgttaggccggatgtcatga 6369584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 364
Target Start/End: Original strand, 6377998 - 6378049
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||| ||| ||||||||| ||||||||||||||||||||||||||| |||||    
T  6377998 aagttctaactcaactggtaaaatgccgaaattgttaggccggatgtcatga 6378049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 358
Target Start/End: Original strand, 23138648 - 23138699
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    ||||||||||||||||| |||||| ||||||| |||||||||||| ||||||    
T  23138648 atccagaagtcctagcttaactggtaaaatgctgaaattgttaggtcggatg 23138699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 43133227 - 43133156
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||| |||||||| | ||||||||||||||| | ||| ||||||| ||||||||||||||||    
T  43133227 aagtcctagctcaaatggcaaaaataccgaaattgttaggctgaatgtcatgaccggggttcgaaccccggt 43133156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 377
Target Start/End: Complemental strand, 47250375 - 47250309
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacc 377  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| |||||||||||||    
T  47250375 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaacc 47250309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 353
Target Start/End: Complemental strand, 5110881 - 5110835
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggcc 353  Q
    ||||||| ||| |||||||||||| ||||||||||||||||||||||    
T  5110881 atccagacgtcttagctcaactggtaaaatgccgaaattgttaggcc 5110835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 5523792 - 5523854
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||  |||||||   |||||| ||||||||||||| |||||||||||||||||    
T  5523792 atccagaagtcctgactcaactaataaaatgtcgaaattgttaggtcggatgccatgaccggg 5523854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 24382593 - 24382647
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    ||||||| ||||||||||||| ||||| |||||||||||||| ||||||| ||||    
T  24382593 cagaagttctagctcaactggtaaaataccgaaattgttaggtcggatgctatga 24382647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 311 - 369
Target Start/End: Complemental strand, 38678288 - 38678230
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||| ||||||||||  ||||| |||||| | |||||||||||||||    
T  38678288 agaagtcctagctcaattggcaaaatgtagaaatagttaggtcagatgccatgaccggg 38678230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 375
Target Start/End: Original strand, 7264404 - 7264473
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaa 375  Q
    ||||| || ||||| |||||||| ||||||||||||||||| ||| ||||||| ||||||| ||||||||    
T  7264404 atccacaaatcctaactcaactgacaaaatgccgaaattgtgaggtcggatgctatgaccgaggttcgaa 7264473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 22752963 - 22752890
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    ||||| |||||||||||||||| | |||||  ||||||||| ||||||||||| |||| | |||||||||||||    
T  22752963 atccataagtcctagctcaactagaaaaatatcgaaattgtaaggccggatgctatgatcggggttcgaacccc 22752890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 369
Target Start/End: Original strand, 28234926 - 28234987
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||| ||||| |||||||| |||||||||||||| |||||||||||||| | ||| ||||||    
T  28234926 tccacaagtcttagctcaattggcaaaatgccgatattgttaggccggacgtcataaccggg 28234987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 323 - 364
Target Start/End: Original strand, 28382604 - 28382645
Alignment:
Q  323 tcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    ||||||||||||||||||||||||||||| |||||| |||||    
T  28382604 tcaactggcaaaatgccgaaattgttaggtcggatgtcatga 28382645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 365
Target Start/End: Original strand, 35196879 - 35196932
Alignment:
Q  313 aagtcctagctcaact-ggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    |||||||||||||||  |||||||||||||||| ||||||| ||||||||||||    
T  35196879 aagtcctagctcaacaaggcaaaatgccgaaatcgttaggctggatgccatgac 35196932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 990218 - 990286
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||| ||||||||||| || |||| | ||||||||||||||||||| |||| | ||||||||||||    
T  990218 agaagtcttagctcaactgacataatggcaaaattgttaggccggatgctatgatcggggttcgaaccc 990286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 4106742 - 4106809
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    |||||||||||| |||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  4106742 agaagtcctagcccaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 4106809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 10092696 - 10092744
Alignment:
Q  330 gcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacc 377  Q
    |||||||||||||||| |||||||||||| ||||||| |||||||||||    
T  10092696 gcaaaatgccgaaattattaggccggatgtcatgaccagggttcgaacc 10092744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 305 - 379
Target Start/End: Complemental strand, 46715822 - 46715746
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    ||||| |||||||||| ||||||||  |||| || |||||||||||||| | ||||||||||| |||||||||||||    
T  46715822 atatctagaagtcctaactcaactgaaaaaaatgtcgaaattgttaggcagaatgccatgaccggggttcgaacccc 46715746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 3043942 - 3043871
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||||||||||||| ||  ||||||  ||||||||||||||||||| |||||  || ||||||||||||    
T  3043942 cagaagtcctagctcaattgataaaatgttgaaattgttaggccggatgtcatgattggagttcgaaccccg 3043871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 356
Target Start/End: Complemental strand, 7162910 - 7162868
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||| ||||||||||||||| ||||||||    
T  7162910 aagtcctagctcaactggc-aaatgccgaaattgtaaggccgga 7162868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 323 - 366
Target Start/End: Complemental strand, 31807160 - 31807117
Alignment:
Q  323 tcaactggcaaaatgccgaaattgttaggccggatgccatgacc 366  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||||    
T  31807160 tcaactggcaaaatgccgaaattattaggccagatgctatgacc 31807117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 308 - 378
Target Start/End: Complemental strand, 43753881 - 43753811
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||| ||||||||| ||||||||||||||  |||||||| | | ||||| ||||||||||||    
T  43753881 tccagaagtcctagttcaactggc-aaatgccgaaattgcaaggccggacgtcgtgacctgggttcgaaccc 43753811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 45350625 - 45350692
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    |||||||| |||||||| |||||||| ||||| ||||| ||||||||||| | | |||||||||||||    
T  45350625 aagtcctatctcaactgacaaaatgctgaaatagttagtccggatgccataatcggggttcgaacccc 45350692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 325 - 378
Target Start/End: Complemental strand, 9932289 - 9932235
Alignment:
Q  325 aactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc 378  Q
    |||||| ||||||||||||||||||||  ||||||||||| ||| ||||||||||    
T  9932289 aactggtaaaatgccgaaattgttaggttggatgccatgatcggagttcgaaccc 9932235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 30627621 - 30627699
Alignment:
Q  306 tatccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||| || ||||||||||||||| | |||||| ||||||||||||  |||||| ||||| || |||||||||||||||    
T  30627621 tatcctgatgtcctagctcaactgacaaaaatgtcgaaattgttagatcggatgtcatgatcgaggttcgaaccccggt 30627699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 301 - 358
Target Start/End: Original strand, 46034303 - 46034361
Alignment:
Q  301 tcacatatccagaagtcctagctcaactggcaaaatgccgaaa-ttgttaggccggatg 358  Q
    |||| |||||| ||||||||| ||||||| |||||||| |||| |||||||||||||||    
T  46034303 tcacttatccataagtcctagttcaactgacaaaatgctgaaaattgttaggccggatg 46034361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 2146640 - 2146684
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    |||||||||||||||||||| |||||||||||||||  ||||||||    
T  2146640 agaagtcctagctcaactgg-aaaatgccgaaattgcaaggccgga 2146684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 375
Target Start/End: Complemental strand, 25546399 - 25546335
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaa 375  Q
    ||||||||||||||||||||  ||||||||||||||  |||||||| | ||||| |||||||||||    
T  25546399 agaagtcctagctcaactgg-taaatgccgaaattgcaaggccggacgtcatgacccgggttcgaa 25546335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 364
Target Start/End: Complemental strand, 28649491 - 28649438
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||| ||||||||||||||| |||||  ||||||||||||| |||||| |||||    
T  28649491 agaaatcctagctcaactggtaaaatagcgaaattgttaggtcggatgtcatga 28649438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 352
Target Start/End: Complemental strand, 38930407 - 38930362
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggc 352  Q
    |||||||||||||||||||| ||||||| || | ||||||||||||    
T  38930407 atccagaagtcctagctcaattggcaaagtgtcaaaattgttaggc 38930362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 46734240 - 46734171
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||| ||||| |||||||| || |||||||||||||| ||||| ||||| | ||||||||||||||    
T  46734240 aagtcctaactcaattggcaaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccg 46734171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 378
Target Start/End: Original strand, 8856308 - 8856348
Alignment:
Q  339 cgaaattgttaggccggatgccatgaccgg-gttcgaaccc 378  Q
    ||||||||||||||||||| |||||||||| ||||||||||    
T  8856308 cgaaattgttaggccggataccatgaccggagttcgaaccc 8856348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #120
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 25112371 - 25112304
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||| |||| |||||||||  ||| |||| | ||||||| ||||||||||||    
T  25112371 agaagtcctagctcaactggc-aaataccgaaattgcaaggtcggacgtcatgacctgggttcgaaccc 25112304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #121
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 356
Target Start/End: Complemental strand, 38504647 - 38504603
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccgga 356  Q
    |||||||||||||| |||||||| |||||||||| ||||||||||    
T  38504647 aagtcctagctcaattggcaaaaatgccgaaatttttaggccgga 38504603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #122
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 43203310 - 43203377
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||| | |||||||||| |||||||||||| |||| ||| ||| ||| ||||||||||||||    
T  43203310 agaagtcctagatgaactggcaaa-tgccgaaattgtaaggcgggacgccgtgacccgggttcgaaccc 43203377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 69; Significance: 8e-31; HSPs: 142)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6672240 - 6672316
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  6672240 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 6672316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 17869253 - 17869177
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  17869253 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 17869177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 18473913 - 18473989
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  18473913 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 18473989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 23311302 - 23311226
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  23311302 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 23311226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 36569278 - 36569354
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  36569278 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 36569354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 25328435 - 25328357
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  25328435 atatctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggt 25328357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2103024 - 2103101
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||    
T  2103024 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcgggattcgaaccccggt 2103101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 4164957 - 4165034
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  4164957 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 4165034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 21728658 - 21728739
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  21728658 tatccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc 21728739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 28143362 - 28143285
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||    
T  28143362 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccggt 28143285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 42448209 - 42448286
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  42448209 tatccagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt 42448286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 1244310 - 1244238
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  1244310 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc 1244238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 36726987 - 36727062
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||    
T  36726987 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggt-gaaccccggt 36727062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 41562457 - 41562533
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||    
T  41562457 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggagttcgaactccggt 41562533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 9054100 - 9054026
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||    
T  9054100 atccagaagtcctagctcaactggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccccg 9054026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 23074774 - 23074697
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  23074774 atccagaagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 23074697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 29119608 - 29119677
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  29119608 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc 29119677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 39151056 - 39150979
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  39151056 tatccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt 39150979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 42068539 - 42068616
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||    
T  42068539 tatccagaagtcctagctcagctggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggt 42068616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 4617895 - 4617819
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  4617895 atccagaagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt 4617819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 16496599 - 16496675
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  16496599 atccagaagtcctagttcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggt 16496675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 24652445 - 24652367
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||    
T  24652445 atatccagaagtcctaactcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggatttgaaccccggt 24652367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 309 - 382
Target Start/End: Original strand, 38682929 - 38683003
Alignment:
Q  309 ccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||    
T  38682929 ccagaagtcctagctcaactggcaaaatgccaaaattgttaggctggatgccatgaccggggttcgaaccccggt 38683003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 9902627 - 9902554
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||    
T  9902627 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgatcggggttcgaaccccggt 9902554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 1650290 - 1650366
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||| |||||||||| |||||    
T  1650290 atccagaagtcctagctcaacctgcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggt 1650366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 34930236 - 34930300
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  34930236 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 34930300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 36136991 - 36136915
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||| ||||||||||||||||    
T  36136991 atccagaagtcctagctcaactagcaaaatgccgaaattgttaggccgaatgctatgaccggggttcgaaccccggt 36136915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 12878248 - 12878173
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccg 380  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||  ||||||||||||    
T  12878248 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcgaagttcgaaccccg 12878173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 37067699 - 37067774
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  37067699 tatctagaagtcctacctcaactgacaaaatgccgaaattgttaggccggatgccatgaccggagttcgaaccccg 37067774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 1269650 - 1269572
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||   ||||||||||||||||    
T  1269650 atatccagaagtcctagctcaactgacaaaatgtcgaaattgttaggccggatgccatgattggggttcgaaccccggt 1269572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 11968774 - 11968848
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    ||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||    
T  11968774 tatccagaagtcctaactcaactgtcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaacccc 11968848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 365
Target Start/End: Complemental strand, 22620780 - 22620722
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  22620780 atccagaagtcctagctcaactgacaaaatgccgaaattgttaggccggatgccatgac 22620722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 311 - 380
Target Start/End: Original strand, 37940921 - 37940991
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||    
T  37940921 agaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccg 37940991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 10393628 - 10393555
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| ||||||||||||||||    
T  10393628 cagaagtcctagctcaactggaaaaatgccgaaattattaggccggatgccttgaccggggttcgaaccccggt 10393555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 12665093 - 12665170
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||| |||||||||| |||||    
T  12665093 tatccagaagtcctagttcaactgacaaaatgccgaaattattaggccggatgccatgaccggggttcgaactccggt 12665170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 12708005 - 12707932
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| | |||||||||||    
T  12708005 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatcaccagagttcgaacccc 12707932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 23310398 - 23310475
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| | |||| |||||||||    
T  23310398 tatccagaagtcctagctcaactggcaaaataccaaaattgttaggccggatgccatgaccagagttcaaaccccggt 23310475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 29806565 - 29806642
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||  ||||||||||||||||    
T  29806565 tatccagaaatcctagctcaactggtaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggt 29806642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 39143439 - 39143512
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccc 378  Q
    |||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |||||||||||    
T  39143439 tatccacaagtcctagctcaactggcaaaatgtcgaaattgttaggccgaatgccatgaccgaggttcgaaccc 39143512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 39527934 - 39528007
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||    
T  39527934 cagaagtcctagttcaactggtaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggt 39528007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 1287314 - 1287390
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||| ||| |||||||||||||||||||| |||||| ||||||| ||||||||||||||||    
T  1287314 atccagaagtcctagctcaattggtaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 1287390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 6041973 - 6041897
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||| ||||||| ||||||||||||| ||||||||| |||||||||||||    
T  6041973 atccagaagtcctagctcaactggtaaaatgtcgaaattattaggccggatgctatgaccgggattcgaaccccggt 6041897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 6053176 - 6053104
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||| ||||||||||||||||    
T  6053176 agaagtcctagctcaactgacaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 6053104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 10154287 - 10154215
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||| |||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||    
T  10154287 agaagtcctaactcaactgacaaaatgccgaaattgtcaggccggatgccatgaccggggttcgaaccccggt 10154215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 14107251 - 14107327
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| |||||||||||||| ||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||    
T  14107251 atccacaagtcctagctcaattggtaaaatgccgaaactgttaggccggatgccatgaccggggttcgaaccccggt 14107327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 16906348 - 16906412
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  16906348 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 16906412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 26267130 - 26267054
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||  |||||||||||||    
T  26267130 atccagaagtcgtagctcaactggcaaaatgccgaaattgttaagccggatgccatgatcggatttcgaaccccggt 26267054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 34675746 - 34675822
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    ||||||||||||||||||||| |||||||||||||||||||||||  ||||||||||| |||| |||||||||||||    
T  34675746 atccagaagtcctagctcaacaggcaaaatgccgaaattgttaggttggatgccatgatcgggattcgaaccccggt 34675822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 36319631 - 36319555
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||  ||||||||||||||||    
T  36319631 atccaaaagtcctagctcaactggcaaaatactgaaattgttaggccggatgccatgacaggggttcgaaccccggt 36319555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 671189 - 671114
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||| | ||||||||||||||    
T  671189 tatccagaagtcctagttcaactggcaaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccg 671114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 1833449 - 1833374
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||    
T  1833449 atccagaagtcatagctcaactggcaaaaatgccgaaattgttaggccggataccatgaccggggttcgaaccccg 1833374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 40318915 - 40318840
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||    
T  40318915 atccagaagtcatagctcaactggcaaaaatgccgaaattgttaggccggataccatgaccggggttcgaaccccg 40318840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 7179430 - 7179368
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||    
T  7179430 atccagaagttctagctcaactggcaaaatgtcgaaattgttaggccagatgccatgaccggg 7179368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 325 - 382
Target Start/End: Complemental strand, 36854269 - 36854211
Alignment:
Q  325 aactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  36854269 aactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 36854211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 40595962 - 40596031
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||||||||||    
T  40595962 aagtcctagctcaactggcaaaatgccgaaattgttaggcc-gatgccatgactggggttcgaaccccggt 40596031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 9068801 - 9068878
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| |||||||||||||||||| |||||| ||||||||||||| |||||||||||| | ||||||||||||||||    
T  9068801 tatccataagtcctagctcaactggtaaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggt 9068878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 14808833 - 14808910
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||  ||||||||||||||||| ||||||||||||||||| |||||||| |||||||||| |||||    
T  14808833 tatccagaagtcctaattcaactggcaaaatgccaaaattgttaggccggatcccatgaccagggttcgaactccggt 14808910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 322 - 382
Target Start/End: Complemental strand, 27390041 - 27389980
Alignment:
Q  322 ctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||    
T  27390041 ctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacctcggt 27389980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 33028228 - 33028305
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| ||||||||||| ||||||| ||||||||| |||||||||||||||||| ||||||| ||||||||||||||||    
T  33028228 tatcaagaagtcctagttcaactgacaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggt 33028305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 314 - 382
Target Start/End: Original strand, 37191250 - 37191319
Alignment:
Q  314 agtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||||||||||||||||||||||| |||||||||||| ||||||||||| |||| |||||||||||||    
T  37191250 agtcctagctcaactggcaaaatgccaaaattgttaggctggatgccatgatcgggattcgaaccccggt 37191319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 307 - 375
Target Start/End: Complemental strand, 40045045 - 40044976
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaa 375  Q
    |||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||    
T  40045045 atccagaagttctagctcagctggcaaaatgccgaaattgttaggtcggatgccatgaccagggttcgaa 40044976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 369
Target Start/End: Complemental strand, 4444978 - 4444915
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||||    
T  4444978 atatccagaagtcctagctcaactggc-aaatgccgaaattgttaggctggataccatgaccggg 4444915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6029611 - 6029687
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||| | |||||||||||||||||| |||| |  ||||||||||||||||    
T  6029611 atccagaagtcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgcctggggttcgaaccccggt 6029687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 10165531 - 10165607
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||||||| ||||| ||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||    
T  10165531 atccataagtcctaactcaattggcaaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccccggt 10165607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 304 - 379
Target Start/End: Complemental strand, 18625747 - 18625671
Alignment:
Q  304 catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    ||||||||||||||||| |||||||||||||||||| |||||||||| || |||||||||| | |||||||||||||    
T  18625747 catatccagaagtcctaactcaactggcaaaatgccaaaattgttagtccagatgccatgatcggggttcgaacccc 18625671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 24051402 - 24051474
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||| |||||||||||||||||  ||||| |||||||||||||||||||| ||||||||||||    
T  24051402 atccagaagtcctaactcaactggcaaaatgctaaaattattaggccggatgccatgaccggggttcgaaccc 24051474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 24443996 - 24443920
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||| |||||||||||||| ||||||  |||||| |||||| |||||||||    
T  24443996 atccagaagtcctagctcaactggcaaaataccgaaattgttaggtcggatgttatgaccggggttcaaaccccggt 24443920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 26802333 - 26802409
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| || |||||||||||||||||| |||||||||||||| ||| ||||||| ||||||||||||||||    
T  26802333 atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggt 26802409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 26809883 - 26809959
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| || |||||||||||||||||| |||||||||||||| ||| ||||||| ||||||||||||||||    
T  26809883 atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggt 26809959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 26824910 - 26824986
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| || |||||||||||||||||| |||||||||||||| ||| ||||||| ||||||||||||||||    
T  26824910 atccagaagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggt 26824986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 33617095 - 33617171
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||   ||||||||||||||||    
T  33617095 atccagaagtcctagctcaactggtaaaatgccgacattgttaggccggatgctatgattggggttcgaaccccggt 33617171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 320 - 382
Target Start/End: Original strand, 34856592 - 34856656
Alignment:
Q  320 agctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
T  34856592 agctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 34856656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 305 - 382
Target Start/End: Complemental strand, 36790447 - 36790368
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| ||||||||||||| ||||||||||| |||||||||| ||||||||||||| |||||| ||||||||||||||||    
T  36790447 atatctagaagtcctagcttaactggcaaaaatgccgaaattattaggccggatgctatgaccggggttcgaaccccggt 36790368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 41408625 - 41408700
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||| ||| ||||||||||||||    
T  41408625 atccagaagtcatagctcaactggcaaaaatgccgaaattgttaggccggataccataaccggggttcgaaccccg 41408700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 43070807 - 43070737
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    |||| |||||| ||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||    
T  43070807 aagtactagcttaactggcaaaatgccgaaattgttaggtcggatgccatgacggaggttcgaaccccggt 43070737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 12769254 - 12769181
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    ||||| |||||||||||||||||| |||||||||||||||||||| |||||||||| ||| | |||||||||||    
T  12769254 atccaaaagtcctagctcaactggtaaaatgccgaaattgttaggtcggatgccatcaccagagttcgaacccc 12769181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 9640663 - 9640587
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||||||||||| |||||||||||| |||| || | |||| |||||||||||||    
T  9640663 atccagaagtcatagctcaactggcaaaatgccgatattgttaggccgaatgctataatcgggattcgaaccccggt 9640587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 369
Target Start/End: Complemental strand, 19836218 - 19836154
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||| |||||||  ||||||||    
T  19836218 atattcagaagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgctgtgaccggg 19836154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 303 - 382
Target Start/End: Complemental strand, 23219253 - 23219173
Alignment:
Q  303 acatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| ||||||||||| ||||||||| |||||||| |||||||||||||| ||||||||| | ||||||||||| ||||    
T  23219253 acatatgcagaagtcctaactcaactggtaaaatgccaaaattgttaggccgtatgccatgatcggggttcgaacctcggt 23219173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 380
Target Start/End: Original strand, 32466566 - 32466642
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||||||||||||| |||||||  |||||| ||||||| ||||||||||||| |||||||| ||||||||||||    
T  32466566 atatccagaagtcctagttcaactgataaaatgtcgaaattattaggccggatgctatgaccggagttcgaaccccg 32466642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 43150283 - 43150211
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||| |||||||||||||||| ||||||||||||||||||||| ||||   ||||||||||||||||    
T  43150283 agaagtcctaactcaactggcaaaatggcgaaattgttaggccggatgctatgattggggttcgaaccccggt 43150211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 5203549 - 5203624
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||| ||||||||  ||||||| || |||||||||||||||||||||||||||| ||||||||||||||    
T  5203549 atccagaagtcttagctcaagaggcaaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccg 5203624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 310 - 365
Target Start/End: Complemental strand, 10070813 - 10070758
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||    
T  10070813 cagaagtcctagctcaactggtaaaatgctgaaattgttaggtcggatgccatgac 10070758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 299 - 354
Target Start/End: Complemental strand, 37142163 - 37142108
Alignment:
Q  299 attcacatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccg 354  Q
    ||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||    
T  37142163 attcatatatccagaagtcctagcttaactggcaaaatgctgaaattgttaggccg 37142108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 358
Target Start/End: Complemental strand, 42337972 - 42337921
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    |||||||| |||||||||||||||||||||||||||||||||||| ||||||    
T  42337972 atccagaattcctagctcaactggcaaaatgccgaaattgttaggtcggatg 42337921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 16371595 - 16371525
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||| ||||||||||||||||| |||||||||||| ||||| ||||| | ||||||||||||||||    
T  16371595 aagtcctagttcaactggcaaaatgccaaaattgttaggctggatgtcatgatcggggttcgaaccccggt 16371525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 317 - 382
Target Start/End: Complemental strand, 32274095 - 32274029
Alignment:
Q  317 cctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| |||||||||||||||| |||||||||||| ||||| |||||||| ||||||||||||||||    
T  32274095 cctagttcaactggcaaaatgctgaaattgttagggcggataccatgaccggggttcgaaccccggt 32274029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 1277436 - 1277513
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    ||||| ||||||||||||| ||| ||||| |||||||||||||||||||||||||||||| ||| |||||||| ||||    
T  1277436 atccacaagtcctagctcagctgccaaaaatgccgaaattgttaggccggatgccatgacagggattcgaacctcggt 1277513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 10011468 - 10011545
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||| ||||||||||||||| || |||||| ||||||||||||| |||||||||||| ||| |||||||| |||||    
T  10011468 tatccaaaagtcctagctcaaccggtaaaatgtcgaaattgttaggtcggatgccatgatcggagttcgaactccggt 10011545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 382
Target Start/End: Original strand, 10458728 - 10458801
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| ||||| ||| |||||||| ||||||||||||||||||| |||| | ||||||||||||||||    
T  10458728 cagaagtcctaactcaattggtaaaatgccaaaattgttaggccggatgctatgatcggggttcgaaccccggt 10458801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 313 - 381
Target Start/End: Complemental strand, 27004088 - 27004019
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccgg 381  Q
    |||||||||||||||||| ||||||||||||||||||| | ||||||||||| | ||||||||| |||||    
T  27004088 aagtcctagctcaactggtaaaatgccgaaattgttagtctggatgccatgatcggggttcgaatcccgg 27004019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 36185135 - 36185212
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||| | |||  ||||| | ||||||||||||||||    
T  36185135 tatccagaaatcctagctcaactggcaaaatgtcgaaattgttaggtcagatatcatgatcggggttcgaaccccggt 36185212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 36246119 - 36246047
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| ||||||||  ||||||| || |||||||||||||||||||||||| ||||||||||||||||    
T  36246119 cagaagtcctaactcaactgaaaaaatgc-gacattgttaggccggatgccatgaccggggttcgaaccccggt 36246047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 25567813 - 25567737
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||| ||||||||| ||||||||||||| ||| |||||| |||||||||||||||||| | ||||||||||||||    
T  25567813 tatccataagtcctagttcaactggcaaaaatgctgaaattattaggccggatgccatgatcggggttcgaaccccg 25567737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 318 - 369
Target Start/End: Complemental strand, 4430059 - 4430008
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||| |||||| |||||||||||||||||||| ||||||||||    
T  4430059 ctagctcaactggtaaaatgtcgaaattgttaggccggatgtcatgaccggg 4430008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 8487395 - 8487458
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||| |||| |||||||||||||||||||||||| ||||||||| || ||||| ||||||||||    
T  8487395 tatctagaaatcctagctcaactggcaaaatgccaaaattgttaagctggatgtcatgaccggg 8487458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 313 - 367
Target Start/End: Complemental strand, 8595611 - 8595556
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg 367  Q
    ||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||    
T  8595611 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggacgtcatgaccg 8595556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 318 - 380
Target Start/End: Original strand, 41071072 - 41071135
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||||| ||| |||||||||||||||||||||||| |||||||| ||| ||||||||||||    
T  41071072 ctagctcaattggtaaaatgccgaaattgttaggccgggtgccatgatcggagttcgaaccccg 41071135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 4228854 - 4228932
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||| || |||||||||||||||||||||| |||||||||||| ||| || |||||| | |||||| |||||||||    
T  4228854 atatccataaatcctagctcaactggcaaaatgtcgaaattgttagaccgaataccatgatcggggttccaaccccggt 4228932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 320 - 381
Target Start/End: Original strand, 5276358 - 5276420
Alignment:
Q  320 agctcaactggcaaaatg-ccgaaattgttaggccggatgccatgaccgggttcgaaccccgg 381  Q
    |||||||||||||||| | ||||||||| || ||||||||||||||||||| |||||||||||    
T  5276358 agctcaactggcaaaaaggccgaaattgctaagccggatgccatgaccggggtcgaaccccgg 5276420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 311 - 365
Target Start/End: Original strand, 34174323 - 34174377
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    |||||||||||||||||||| |||||| | |||||||||| ||||||||||||||    
T  34174323 agaagtcctagctcaactggtaaaatgacaaaattgttagaccggatgccatgac 34174377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 972720 - 972647
Alignment:
Q  311 agaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| ||||||| ||||| || ||||||||||||| ||||||| |||||| ||||||||||||||||    
T  972720 agaagtcctagttcaactgacaaaaatgtcgaaattgttaggtcggatgctatgaccagggttcgaaccccggt 972647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 15067270 - 15067193
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||| ||||||||||| ||| |||| || ||||||||||||||||||||| |||| | ||||||||||||||||    
T  15067270 atccagaattcctagctcaattggaaaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggt 15067193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 302 - 382
Target Start/End: Original strand, 17080459 - 17080540
Alignment:
Q  302 cacatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||| |||||||| ||||||||||| ||||||| ||||||||||| | |||||| ||||||  ||||||||||| ||||    
T  17080459 cacatattcagaagtcgtagctcaactgacaaaatgtcgaaattgttaagtcggatgtcatgacgggggttcgaacctcggt 17080540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 305 - 362
Target Start/End: Original strand, 19090431 - 19090488
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccat 362  Q
    ||||||||||||| |||||||||||| |||||| | ||||||||||||| ||||||||    
T  19090431 atatccagaagtcttagctcaactggtaaaatgtcaaaattgttaggccagatgccat 19090488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 28391171 - 28391244
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc 378  Q
    |||||||||||||||||| || | | |||||||||||||||||||| || ||||||||| ||| ||||||||||    
T  28391171 tatccagaagtcctagctaaattcgtaaaatgccgaaattgttaggtcgaatgccatgatcggagttcgaaccc 28391244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 6219315 - 6219247
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc 378  Q
    ||||||||||| | |||||| |||| ||||||||||||||| |||||| ||||||||| ||||||||||    
T  6219315 agaagtcctagtttaactggtaaaacgccgaaattgttaggtcggatgtcatgaccggtgttcgaaccc 6219247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 29293651 - 29293575
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||| |||| | || ||||||| ||||||||||||||||||||||||||||| | ||||||||||| ||||    
T  29293651 atccaaaagttctagttgaattggcaaagtgccgaaattgttaggccggatgccatgatcggggttcgaacctcggt 29293575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 40199229 - 40199157
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    |||| ||||||||||||||  ||||||||||||||||||||| ||||| ||||| ||  ||||||||||||||    
T  40199229 agaaatcctagctcaactgataaaatgccgaaattgttaggctggatgtcatgatcgaagttcgaaccccggt 40199157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 377
Target Start/End: Complemental strand, 1931218 - 1931147
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaacc 377  Q
    ||||| || |||| ||||||||| ||||||| ||||||||||||||||||||| |||||  |||||||||||    
T  1931218 atccataaatcctcgctcaactgacaaaatgtcgaaattgttaggccggatgctatgactggggttcgaacc 1931147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 306 - 364
Target Start/End: Complemental strand, 2706260 - 2706202
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||||||||| |||||| |||||||||||||| ||||| | ||||| ||||    
T  2706260 tatccagaagtcctagcttaactggtaaaatgccgaaattattaggtcagatgctatga 2706202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 322 - 379
Target Start/End: Complemental strand, 20695597 - 20695539
Alignment:
Q  322 ctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||  ||||||||||||||||||||||| |||| ||||||| |||||||||||||    
T  20695597 ctcaactaacaaaatgccgaaattgttaggcccgatgtcatgaccggggttcgaacccc 20695539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 351
Target Start/End: Original strand, 29069633 - 29069671
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttagg 351  Q
    |||||||||||||||||||||||| ||||||||||||||    
T  29069633 aagtcctagctcaactggcaaaataccgaaattgttagg 29069671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 380
Target Start/End: Complemental strand, 12638596 - 12638523
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg 380  Q
    |||| |||||||||||||||| | |||||  |||||||||||||||||| ||| ||||  ||||||||||||||    
T  12638596 tccaaaagtcctagctcaactagtaaaatatcgaaattgttaggccggacgccttgacgggggttcgaaccccg 12638523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 13550379 - 13550303
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc--gggttcgaaccccg 380  Q
    ||||||||| |||||||||||| |||||||||  || ||| |||||| |||| ||||||||  ||||||||||||||    
T  13550379 tatccagaaatcctagctcaacgggcaaaatgttgagatttttaggctggataccatgaccgggggttcgaaccccg 13550303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 380
Target Start/End: Complemental strand, 18692579 - 18692506
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccg 380  Q
    |||| |||||||| |||||| ||||||||||| ||||| |||| ||| || ||||||||||| |||||||||||    
T  18692579 tccacaagtcctacctcaaccggcaaaatgccaaaattattagaccgaataccatgaccgggattcgaaccccg 18692506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 380
Target Start/End: Complemental strand, 22792234 - 22792165
Alignment:
Q  313 aagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg 380  Q
    ||||||||||||||||||| |||||||||||||||||||| |||| | | ||||  ||||||||||||||    
T  22792234 aagtcctagctcaactggcaaaaatgccgaaattgttaggtcggacgtcttgacaggggttcgaaccccg 22792165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 380
Target Start/End: Original strand, 29622237 - 29622278
Alignment:
Q  340 gaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||||||||||||||||||| ||||||||||||||    
T  29622237 gaaattgttaggccggatgccatgaccggggttcgaaccccg 29622278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 358
Target Start/End: Complemental strand, 7153318 - 7153266
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    |||||| |||||||||||||||||| |||  | ||||||||||||||||||||    
T  7153318 tatccacaagtcctagctcaactggtaaatagtcgaaattgttaggccggatg 7153266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 7670365 - 7670441
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||| |||||||||||||||||||||  ||||||||||  |||||  ||||| | ||||||||||||||||    
T  7670365 atccataagttctagctcaactggcaaaatgctaaaattgttagatcggatatcatgatcggggttcgaaccccggt 7670441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 13203961 - 13204028
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | | ||| ||||||||||||||    
T  13203961 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaaccc 13204028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 18115092 - 18115168
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    ||||| |||| ||| ||||||| |||||||| | ||||||||||||||||| || |||||||| |||||| ||||||    
T  18115092 atccaaaagttctaactcaactagcaaaatgtcaaaattgttaggccggataccgtgaccgggattcgaaacccggt 18115168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 31895640 - 31895565
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||||| |||| ||||||| |||| ||||||||||||||||| ||||| ||||||   |||||||||||||||    
T  31895640 atccagaagttctagatcaactgccaaa-tgccgaaattgttaggcaggatgtcatgactaaggttcgaaccccggt 31895565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 317 - 369
Target Start/End: Original strand, 42653550 - 42653602
Alignment:
Q  317 cctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||| |||||||| ||||||| |||||||||||| ||||||| ||||||||||    
T  42653550 cctaactcaactgacaaaatgtcgaaattgttagaccggatgtcatgaccggg 42653602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 312 - 382
Target Start/End: Complemental strand, 2025805 - 2025734
Alignment:
Q  312 gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||| ||||||||  ||||||| |||||||||||| |||||| ||||| | |||||||||| |||||    
T  2025805 gaagtcctaactcaactgataaaatgcggaaattgttaggtcggatgtcatgatcggggttcgaactccggt 2025734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 380
Target Start/End: Complemental strand, 13549281 - 13549206
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccg 380  Q
    ||||||||| |  ||||||||||||||||||| | ||||| |||||||||||  ||||||  ||||||||||||||    
T  13549281 tatccagaaattatagctcaactggcaaaatgtcaaaatttttaggccggatatcatgacaggggttcgaaccccg 13549206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 22963693 - 22963760
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    |||| |||||||||||| |||||||| |||||| ||||| ||||| |||||| | |||||||||||||    
T  22963693 aagttctagctcaactgacaaaatgctgaaattattaggtcggataccatgatcagggttcgaacccc 22963760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 26526517 - 26526588
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||| | ||||||||||||||||| | | |||||||| ||||||||| |||||    
T  26526517 aagtcttagctcaactggcaaaaataccgaaattgttaggccgaacgtcatgaccgaggttcgaactccggt 26526588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #129
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 364
Target Start/End: Original strand, 28489180 - 28489239
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga 364  Q
    ||||| |||||||||| ||||||| ||||| |||||||||| ||||||||||||| ||||    
T  28489180 tatccggaagtcctagttcaactgacaaaaatgccgaaattattaggccggatgctatga 28489239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 36259821 - 36259872
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| |||||||||||||||||||| ||||||| ||||||||| ||||||    
T  36259821 aaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggt 36259872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 353
Target Start/End: Original strand, 12257360 - 12257401
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggcc 353  Q
    ||||||||||||||||||||| ||||||||||||||| |||||    
T  12257360 agaagtcctagctcaactggc-aaatgccgaaattgtaaggcc 12257401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 310 - 356
Target Start/End: Original strand, 21067439 - 21067485
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| |||||  ||||||||||||| ||||    
T  21067439 cagaagtcctagctcaactggtaaaatatcgaaattgttaggtcgga 21067485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #133
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 24637951 - 24638029
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| ||||| ||||||||| ||  ||||||  ||||||||||||||||||| |||||   ||||||||||||||||    
T  24637951 atatcctgaagttctagctcaattgataaaatgttgaaattgttaggccggatgtcatgattggggttcgaaccccggt 24638029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 4825063 - 4825019
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| ||||||||||||||  ||||||||    
T  4825063 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga 4825019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 318 - 382
Target Start/End: Complemental strand, 9362606 - 9362541
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||||||||||| ||||||   |||||||||||||| ||| ||||| ||| ||||||||||||||    
T  9362606 ctagctcaactggtaaaatgataaaattgttaggccgaatgtcatgatcggagttcgaaccccggt 9362541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 310 - 351
Target Start/End: Complemental strand, 12819671 - 12819630
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttagg 351  Q
    ||||||||||| ||||| ||| ||||||||||||||||||||    
T  12819671 cagaagtcctaactcaattggtaaaatgccgaaattgttagg 12819630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #137
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 1191664 - 1191597
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||| ||||||||  |||||||| | | ||| ||||||||||||||    
T  1191664 agaagtcctagctcaactggc-aaatgacgaaattgcaaggccggacgtcgtgatccgggttcgaaccc 1191597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #138
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 356
Target Start/End: Original strand, 8733997 - 8734044
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    |||||||||||||||||||||||| |||||| |||||||  ||||||||    
T  8733997 tccagaagtcctagctcaactggc-aaatgctgaaattgcaaggccgga 8734044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 9577085 - 9577018
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||| |||||| |||||||  ||||| || | ||||||| ||||||||||||    
T  9577085 agaagtcctagctcaactggc-aaatgctgaaattgcaaggccagacgtcatgacctgggttcgaaccc 9577018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 356
Target Start/End: Original strand, 30527986 - 30528030
Alignment:
Q  313 aagtcctagctcaactggc-aaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||| ||  |||||||||||||||||||||||||    
T  30527986 aagtcctagctcaaccggtgaaaatgccgaaattgttaggccgga 30528030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 356
Target Start/End: Original strand, 30568326 - 30568370
Alignment:
Q  313 aagtcctagctcaactggc-aaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||| ||  |||||||||||||||||||||||||    
T  30568326 aagtcctagctcaaccggtgaaaatgccgaaattgttaggccgga 30568370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 306 - 358
Target Start/End: Complemental strand, 42559959 - 42559907
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    |||||| ||||| |||| ||| || ||||||| ||||||||||||||||||||    
T  42559959 tatccacaagtcatagcacaaatgacaaaatgtcgaaattgttaggccggatg 42559907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 69; Significance: 8e-31; HSPs: 140)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 3848948 - 3848868
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||    
T  3848948 tatccagaagtcctagctcaactggcaaaatgccgaaattgctaggccggatgccatgaccggggttcgaaccccggtgcc 3848868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 12821164 - 12821240
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  12821164 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 12821240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 49882838 - 49882762
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  49882838 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggt 49882762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 304 - 382
Target Start/End: Original strand, 35828270 - 35828349
Alignment:
Q  304 catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  35828270 catattcagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 35828349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 7512765 - 7512842
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||    
T  7512765 tatccagaagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggt 7512842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 47462166 - 47462089
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  47462166 tatctagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 47462089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 5397069 - 5396993
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  5397069 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 5396993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 30044713 - 30044637
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  30044713 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 30044637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 42154267 - 42154191
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  42154267 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 42154191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 49535883 - 49535957
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  49535883 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaacccc 49535957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 9569473 - 9569546
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  9569473 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccc 9569546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 46488247 - 46488170
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||    
T  46488247 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcaaaccccggt 46488170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 50779921 - 50779844
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  50779921 tatccagaagtcttagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggt 50779844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 1033574 - 1033506
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  1033574 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc 1033506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 14285094 - 14285170
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||    
T  14285094 atccagaagtcctagctcaactgacaaaatgccaaaattgttaggccggatgccatgaccggcgttcgaaccccggt 14285170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 24712087 - 24712163
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||    
T  24712087 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 24712163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 303 - 382
Target Start/End: Complemental strand, 42412121 - 42412041
Alignment:
Q  303 acatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||    
T  42412121 acatttccagaagtcatagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggt 42412041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 380
Target Start/End: Original strand, 37050703 - 37050774
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  37050703 cagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccg 37050774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 42856562 - 42856624
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  42856562 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggg 42856624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 29428053 - 29428130
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| | ||||||||||||||||    
T  29428053 tatccagaagtcctagctcaactggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt 29428130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 13389019 - 13389095
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||| ||||||||||||||||    
T  13389019 atccagaagtcctagctcaactggcaaaatgctgaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 13389095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 18813373 - 18813445
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||    
T  18813373 agaagtcctaactcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgggcttcgaaccccggt 18813445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 23974771 - 23974699
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccc 378  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||| ||||||||||    
T  23974771 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatatcatgaccggtgttcgaaccc 23974699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 24550812 - 24550888
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||    
T  24550812 atccagaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt 24550888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 31263630 - 31263554
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||| ||||||||||||||||    
T  31263630 atccagaagtcctagctcaactggcaaaatgtcgaaattattagaccggatgccatgaccggggttcgaaccccggt 31263554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 34684202 - 34684277
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  34684202 atccagaagtc-tagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 34684277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 54908017 - 54907945
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||    
T  54908017 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcgaggtttgaaccccggt 54907945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 1982559 - 1982622
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||    
T  1982559 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgtatgtcatgaccggg 1982622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 13632087 - 13632162
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaacccc 379  Q
    |||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||    
T  13632087 tatccagaagtcctagctcaactggcaaaaatgtcgaaattgttaggccggatgccatgaccgaggttcgaacccc 13632162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 313 - 379
Target Start/End: Original strand, 28033197 - 28033264
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
T  28033197 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacccc 28033264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 312 - 382
Target Start/End: Original strand, 37166142 - 37166213
Alignment:
Q  312 gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||    
T  37166142 gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggt 37166213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 3084371 - 3084309
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||    
T  3084371 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgatcggg 3084309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 380
Target Start/End: Original strand, 4379306 - 4379380
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||    
T  4379306 atccagaagtcctagttcaactgacaaaatgccgaaattgttaggccggatgccatgaccggagttcgaatcccg 4379380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 24407502 - 24407572
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||    
T  24407502 aagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgccatgaccgggattcgaaccccggt 24407572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 319 - 380
Target Start/End: Original strand, 51281477 - 51281539
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  51281477 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggagttcgaaccccg 51281539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 49319729 - 49319802
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||||  ||||||| |||||||||||||||||||||||||||| ||||||||||||    
T  49319729 tatccagaagtcctagctcaactaacaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccc 49319802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 28010180 - 28010104
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||||||||| |||||||||||| ||||  ||||||| ||||||||||||||||    
T  28010180 atccagaagtcctagctcaactggcaaaatgccaaaattgttaggcaggatatcatgaccggggttcgaaccccggt 28010104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 29648763 - 29648835
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||| ||||||||||||    
T  29648763 atccagaagtcctagctcaactagcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccc 29648835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 36526270 - 36526194
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||   ||||||||||||||||    
T  36526270 atccagaagtcctagctcaactagcaaaaagccgaaattgttaggccggatgccatgattggggttcgaaccccggt 36526194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 5880412 - 5880341
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||    
T  5880412 cagaagtcctaactcaactggcaaaatgtcgaaattgttagaccggatgccatgaccggggttcgaaccccg 5880341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 306 - 369
Target Start/End: Original strand, 12694521 - 12694584
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||    
T  12694521 tatccagaagtcctagctcaactgacaaaatgctgaaactgttaggccggatgccatgaccggg 12694584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 380
Target Start/End: Complemental strand, 52556509 - 52556438
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    ||||| |||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||    
T  52556509 cagaaatcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgatcggggttcgaaccccg 52556438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 35318539 - 35318601
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||  ||||||||||    
T  35318539 atccagaagtcctaactcaactggcaaaatgccgaaattgttaggccggatatcatgaccggg 35318601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 316 - 381
Target Start/End: Complemental strand, 51564511 - 51564445
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccgg 381  Q
    |||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||    
T  51564511 tcctagctcaactggcaaaatgccgaaactgttaggccggacgccatgaccagggttcgaaccccgg 51564445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 318 - 382
Target Start/End: Complemental strand, 25586445 - 25586380
Alignment:
Q  318 ctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
T  25586445 ctagctcaactagcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggt 25586380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 28983730 - 28983807
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||||||||||| ||| ||||||||| |||||||||||||| |||||||||| |||||    
T  28983730 tatccagaagttctagctcaactggcaaaatgtcgacattgttaggtcggatgccatgaccggggttcgaactccggt 28983807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 313 - 380
Target Start/End: Original strand, 11673298 - 11673366
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||||||||||||||||||| ||||||||||||||| ||||||||||| | ||||||||||||||    
T  11673298 aagtcctagctcaactggcaaaataccgaaattgttaggcaggatgccatgatcggggttcgaaccccg 11673366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 378
Target Start/End: Original strand, 29894409 - 29894481
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||| ||||||| ||||| |||||| ||||||| ||||||||||||    
T  29894409 atccagaagtcctagctcaactggcaaaatgtcgaaattattaggtcggatgtcatgaccggggttcgaaccc 29894481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 31375112 - 31375188
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||| |||||||| ||||||| ||||||| ||||||| |||||||||||| ||||||||||||||||    
T  31375112 atccagaagtcctaactcaactgccaaaatgtcgaaattattaggccagatgccatgaccggggttcgaaccccggt 31375188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 1083506 - 1083581
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| | |||| ||||| | ||||||||||||||    
T  1083506 tatccagaagtcctagttcaactggcaaaatgccgaaattgttaggtcagatgtcatgatcggggttcgaaccccg 1083581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 10758016 - 10757945
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc 378  Q
    |||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||| | ||| ||||||    
T  10758016 atccagaagtcctacctcaactgccaaaatgccgaaattgttaggtcggatgccatgacggagtttgaaccc 10757945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 10971187 - 10971116
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccc 378  Q
    |||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||| | ||| ||||||    
T  10971187 atccagaagtcctacctcaactgccaaaatgccgaaattgttaggtcggatgccatgacggagtttgaaccc 10971116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 32104136 - 32104077
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||    
T  32104136 cagaagtcttagctaaaatggcaaaatgccgaaattgttaggccggatgccatgaccggg 32104077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 36752357 - 36752432
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    ||||||||||||||| |||||||| ||||||||||||||||||||||| |||| ||||| | ||||||||||||||    
T  36752357 tatccagaagtcctaactcaactgacaaaatgccgaaattgttaggccagatgtcatgatcggggttcgaaccccg 36752432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 316 - 382
Target Start/End: Complemental strand, 39284694 - 39284628
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  39284694 tcctagctcaactggcaaa-tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 39284628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 6487848 - 6487921
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||   |||||||||||||||||||||||||||| | ||||| ||||||||||||||||    
T  6487848 atccagaagtcctagctcaac---caaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggt 6487921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 305 - 378
Target Start/End: Complemental strand, 39301401 - 39301327
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||| |||||||||||| ||||||| ||||||||||||||  ||||||| ||||||||||||    
T  39301401 atatccagaagtcctagttcaactggcaaactgccgaatttgttaggccggatatcatgaccagggttcgaaccc 39301327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 26440965 - 26441038
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    |||||| || |||||||||||||||||||||||||||||||||||||||| || ||||||| |||||| |||||    
T  26440965 tatccaaaaatcctagctcaactggcaaaatgccgaaattgttaggccgggtgtcatgaccagggttccaaccc 26441038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 31436048 - 31435971
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| ||||||||| |||||||| ||||||||||||||||||||||||||| |||||   ||||||||||||||||    
T  31436048 tatccacaagtcctagttcaactggtaaaatgccgaaattgttaggccggatgtcatgattggggttcgaaccccggt 31435971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 310 - 378
Target Start/End: Complemental strand, 33416706 - 33416637
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||| | ||||||||||||    
T  33416706 cagaagtcctagctcaactggcaaaataccgaaattgttagaccggatgtcatgatcagggttcgaaccc 33416637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 42116480 - 42116556
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||| |||||||||||||| |||||| ||||||| ||||| |||||||||||| | ||||||||||||||||    
T  42116480 atccagaagccctagctcaactggtaaaatgtcgaaatttttaggtcggatgccatgatcggggttcgaaccccggt 42116556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 307 - 381
Target Start/End: Original strand, 3037236 - 3037311
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccgg 381  Q
    |||||||| |||||||||||||| ||||||||||||||| |||||| ||||| ||||||| |||||||||| ||||    
T  3037236 atccagaaatcctagctcaactgtcaaaatgccgaaattattaggctggatgtcatgaccggggttcgaactccgg 3037311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 12316059 - 12315985
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||| |||||||||||||  |||||| |||||| |||||||| |||||||||||| ||||||||||||||    
T  12316059 atccagaagccctagctcaactgaaaaaatgtcgaaatagttaggccagatgccatgaccagggttcgaaccccg 12315985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Complemental strand, 17518602 - 17518540
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||| |||||||||||| |||||||| ||||||||| |||||||||||||| ||||    
T  17518602 atccagaagtcttagctcaactggtaaaatgccaaaattgttacgccggatgccatgatcggg 17518540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 376
Target Start/End: Complemental strand, 25699069 - 25698999
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaac 376  Q
    ||||||||||||||||||||  ||||||||| ||||||| |||||||||||||||||| ||| ||||||||    
T  25699069 atccagaagtcctagctcaagaggcaaaatgtcgaaattattaggccggatgccatgatcggagttcgaac 25698999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 44171648 - 44171710
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||| |||||||||| ||||| ||| |||||||| ||||||||||    
T  44171648 atccagaagtcctagctcaactagcaaaatgccaaaattattaagccggatgacatgaccggg 44171710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 310 - 364
Target Start/End: Original strand, 51425332 - 51425386
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    |||||||||||| |||||| ||||||||||||||||||||||||||||| |||||    
T  51425332 cagaagtcctagttcaactagcaaaatgccgaaattgttaggccggatgtcatga 51425386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 39997903 - 39997826
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| |||| ||||||||||||||  |||||| ||||||||||||||||||| |||||||| ||||||||||| ||||    
T  39997903 tatctagaactcctagctcaactgataaaatgtcgaaattgttaggccggataccatgaccggggttcgaacctcggt 39997826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 579367 - 579295
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||| ||||||||||||||  |||||| |||||||||||||||||||| ||||| | ||||||||||||||||    
T  579367 agaaatcctagctcaactgataaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggt 579295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 319 - 378
Target Start/End: Complemental strand, 1053000 - 1052940
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||| ||||||| |||||||||||||||||||| ||||||| ||||||||||||    
T  1053000 tagctcaactgacaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccc 1052940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 18371349 - 18371421
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||| ||||||||||||||||||||||||||||||||||||| ||  ||||||  ||||| ||||||||||    
T  18371349 agaagttctagctcaactggcaaaatgccgaaattgttaggccgaatatcatgactggggtttgaaccccggt 18371421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 307 - 366
Target Start/End: Complemental strand, 55853444 - 55853384
Alignment:
Q  307 atccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgacc 366  Q
    ||||||||||||||||||||||||| |||||||| |||||||||||  |||||||||||||    
T  55853444 atccagaagtcctagctcaactggcaaaaatgccaaaattgttaggttggatgccatgacc 55853384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 308 - 379
Target Start/End: Complemental strand, 17815270 - 17815199
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaacccc 379  Q
    |||| ||||||||| ||||||||||||||||||||||||||||| || | | |||||| | |||||||||||    
T  17815270 tccacaagtcctagttcaactggcaaaatgccgaaattgttaggtcgaacgtcatgactgagttcgaacccc 17815199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 24870601 - 24870672
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||||||||||||||||||| ||||||||||||||||||||| |  ||||||| |||||||||| ||||    
T  24870601 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggacgtaatgaccgaggttcgaacctcggt 24870672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 29334503 - 29334570
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||||| |||||||||||||| |||||||||||||| |||||| ||||||||| |||| |||||||||    
T  29334503 tcctagttcaactggcaaaataccgaaattgttaggtcggatgtcatgaccggagttcaaaccccggt 29334570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 324 - 382
Target Start/End: Complemental strand, 34660903 - 34660844
Alignment:
Q  324 caactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||    
T  34660903 caactggcaaaatgcctaaattgttaggtcggatgtcatgaccggggttcgaaccccggt 34660844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 313 - 378
Target Start/End: Original strand, 46343333 - 46343400
Alignment:
Q  313 aagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||| ||||| ||||||||||||||||||||| | ||||||| ||||||||||||    
T  46343333 aagtcctagctcaactgacaaaagtgccgaaattgttaggccggacgtcatgaccggggttcgaaccc 46343400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 8810896 - 8810822
Alignment:
Q  310 cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    |||| ||||||||||||||| ||||| |||||||||| ||||| |||||| ||||||||| ||||||||||||||    
T  8810896 cagatgtcctagctcaactgacaaaaatgccgaaattattaggtcggatgtcatgaccggagttcgaaccccggt 8810822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 310 - 368
Target Start/End: Complemental strand, 9038332 - 9038274
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg 368  Q
    ||||||| ||||||||||| ||||||||||||||||||| | ||||||| |||||||||    
T  9038332 cagaagttctagctcaactagcaaaatgccgaaattgtttgaccggatgtcatgaccgg 9038274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 332 - 382
Target Start/End: Complemental strand, 11311630 - 11311580
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||| |||||| |||||||||| |||||    
T  11311630 aaaatgccgaaattgttaggccggatgtcatgacggggttcgaactccggt 11311580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 17271304 - 17271374
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||| | |||||||||||||||||||||||  ||||||||||  ||||| ||||||||||    
T  17271304 aagtcctagctcaacggacaaaatgccgaaattgttaggccaaatgccatgactggggtttgaaccccggt 17271374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 311 - 369
Target Start/End: Complemental strand, 28187289 - 28187231
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||  |||||| ||||||||||||||||||||| |||| ||||    
T  28187289 agaagtcctagctcaactgataaaatgtcgaaattgttaggccggatgctatgatcggg 28187231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 307 - 364
Target Start/End: Complemental strand, 35273436 - 35273378
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga 364  Q
    ||||| ||||||||||||||||||||||| || |||||||||||||||| |||||||||    
T  35273436 atccacaagtcctagctcaactggcaaaaatgtcgaaattgttaggccgtatgccatga 35273378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 313 - 382
Target Start/End: Original strand, 46194254 - 46194324
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||| | ||||||||||| |||||| ||||| | |||||||||| |||||    
T  46194254 aagtcctagctcaactggcaaaatgtcaaaattgttaggtcggatgtcatgatcagggttcgaactccggt 46194324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 55214484 - 55214550
Alignment:
Q  316 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    |||||||||||||| ||||||||  ||||||||||| |||||||||||||||  |||||| ||||||    
T  55214484 tcctagctcaactgacaaaatgctaaaattgttaggtcggatgccatgaccgaattcgaatcccggt 55214550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 9064919 - 9064842
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| |||||||||||||||| | ||||||| |||||||||||| || ||||||| | | ||||||||||||||||    
T  9064919 tatccacaagtcctagctcaactagtaaaatgctgaaattgttaggtcgaatgccataatcggggttcgaaccccggt 9064842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 378
Target Start/End: Complemental strand, 9749212 - 9749139
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccggg-ttcgaaccc 378  Q
    ||||||||||||||| |||| ||| |||| |||||||||||||| |||||||||||||| |||| |||||||||    
T  9749212 atccagaagtcctagttcaattggtaaaaatgccgaaattgttatgccggatgccatgatcgggattcgaaccc 9749139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 11371190 - 11371113
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||| ||||||| |||||||| | |||||||||||||||||||  ||| |||||||  ||||||||||||||||    
T  11371190 tatccagacgtcctagttcaactggaataatgccgaaattgttaggctagataccatgacaggggttcgaaccccggt 11371113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 17480930 - 17481007
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||| |||| |||||||||||| ||||| |||| |||||||||||||| ||||||||| | ||||||||||||||||    
T  17480930 atccacaagttctagctcaactgacaaaaatgccaaaattgttaggccgaatgccatgatcagggttcgaaccccggt 17481007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 382 - 423
Target Start/End: Complemental strand, 28391019 - 28390978
Alignment:
Q  382 tgccatctccttggatttcaattgcagcaaaccttgatgatg 423  Q
    ||||||||||||| ||||||||||||||||||||||||||||    
T  28391019 tgccatctccttgaatttcaattgcagcaaaccttgatgatg 28390978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 54086010 - 54086083
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    ||||| ||||||||||||||||| |||||| |||||||||||| | ||||| |||||| | |||||||||||||    
T  54086010 atccaaaagtcctagctcaactgacaaaataccgaaattgttaagtcggataccatgatcggggttcgaacccc 54086083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 1173955 - 1174022
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||||| ||||||||||||    
T  1173955 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacctgggttcgaaccc 1174022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 305 - 380
Target Start/End: Complemental strand, 5060541 - 5060465
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccg 380  Q
    |||||||||||||||| ||||||||  |||||| |||||||||||| ||||||  ||||| ||| ||||||||||||    
T  5060541 atatccagaagtcctaactcaactgataaaatgtcgaaattgttagtccggatatcatgatcggcgttcgaaccccg 5060465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 19225263 - 19225330
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||| | |||||| | ||||| ||||||||||||||    
T  19225263 agaagtcctagctcaactggc-aaatgccgaaattgtaaagccggacgtcatgatccgggttcgaaccc 19225330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 21172878 - 21172954
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||||| |||||||||| ||||||||||||||||||  |||||||  ||||   ||||||||||||||||    
T  21172878 atccagaagtcctggctcaactggtaaaatgccgaaattgttaaaccggatgttatgattggggttcgaaccccggt 21172954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 34739284 - 34739351
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  34739284 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 34739351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 332 - 380
Target Start/End: Original strand, 43588790 - 43588838
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccg 380  Q
    ||||||| ||||||||||||||||||| ||||| |||||||||||||||    
T  43588790 aaaatgcggaaattgttaggccggatgtcatgatcgggttcgaaccccg 43588838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 319 - 382
Target Start/End: Original strand, 47384209 - 47384273
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||  |||||| || ||||||||||||||||| ||||||| ||||||||||||||||    
T  47384209 tagctcaactgataaaatgtcggaattgttaggccggatgtcatgaccagggttcgaaccccggt 47384273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 54768556 - 54768489
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  54768556 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 54768489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 4901924 - 4901983
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||||||||| ||||  |||||| | ||||||||||||||||||| |||||||||    
T  4901924 cagaagtcctagctcgactgataaaatgtcaaaattgttaggccggatgctatgaccggg 4901983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 382
Target Start/End: Complemental strand, 7944324 - 7944277
Alignment:
Q  336 tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||| ||||||| ||||||||||||||||    
T  7944324 tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggt 7944277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 304 - 382
Target Start/End: Complemental strand, 17846882 - 17846803
Alignment:
Q  304 catatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    |||||| | |||| |||||||||||||||||||| |||||||||||||| |||| | |||| || |||||||||| ||||    
T  17846882 catatctaaaagttctagctcaactggcaaaatgtcgaaattgttaggctggatcctatgatcgaggttcgaacctcggt 17846803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 21378293 - 21378363
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||||||||||||||||||||| ||       |||||||||||||||||||||||||||| |||||||||| |||||    
T  21378293 tatccagaagtcctagctcaactagc-------cgaaattgttaggccggatgccatgaccggggttcgaactccggt 21378363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 46552949 - 46553000
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||| |||||||||||||||||| ||||||| ||||||||||||||||    
T  46552949 aaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggt 46553000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 310 - 369
Target Start/End: Original strand, 54864398 - 54864457
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||| |||||| |||||||| | ||||||||||| |||||||||||| ||||    
T  54864398 cagaagtcctagatcaactagcaaaatgtcaaaattgttaggtcggatgccatgatcggg 54864457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 369
Target Start/End: Complemental strand, 21156084 - 21156022
Alignment:
Q  308 tccagaagtcctagctcaactggc-aaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||| ||||||||||||||||||| ||||||||||||||| ||||| ||| ||| ||||||||    
T  21156084 tccacaagtcctagctcaactggcaaaaatgccgaaattgctaggctggacgccgtgaccggg 21156022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 380
Target Start/End: Original strand, 33840619 - 33840693
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatga-ccgggttcgaaccccg 380  Q
    |||| |||||||||||||||| |||||| |||||||||| |||||||||| ||||| | | ||||||||||||||    
T  33840619 tccacaagtcctagctcaactagcaaaaatgccgaaattattaggccggacgccataatcggggttcgaaccccg 33840693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 316 - 382
Target Start/End: Original strand, 38882724 - 38882793
Alignment:
Q  316 tcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccgg-gttcgaaccccggt 382  Q
    ||||||||||||||||||||  || |||||||||||||| ||| | ||||||||| ||||||||||||||    
T  38882724 tcctagctcaactggcaaaaaatgtcgaaattgttaggctggacgtcatgaccggagttcgaaccccggt 38882793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 382
Target Start/End: Complemental strand, 48628587 - 48628517
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||||||||||||| ||| |||| ||||||||||   ||||||||||||  ||||||||||||||||    
T  48628587 aagtcctagctcaactggtaaagtgccaaaattgttagattggatgccatgactggggttcgaaccccggt 48628517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 379
Target Start/End: Complemental strand, 12619312 - 12619239
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    |||||||||||||| |||||||| |||||| |||||||| ||| |||||||| || || | |||||||||||||    
T  12619312 atccagaagtcctaactcaactgacaaaataccgaaattattaagccggatgtcaagatcagggttcgaacccc 12619239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 352
Target Start/End: Complemental strand, 31010074 - 31010029
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggc 352  Q
    ||||| ||||| |||||||||||| |||||||||||||||||||||    
T  31010074 atccataagtcttagctcaactggtaaaatgccgaaattgttaggc 31010029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 51675797 - 51675720
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||| ||||||||||||||||  ||||||  | |||||||||||||||||  ||||||| |||||||||| |||||    
T  51675797 tatccataagtcctagctcaactaacaaaatatctaaattgttaggccggatatcatgaccggggttcgaactccggt 51675720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 382
Target Start/End: Complemental strand, 52303226 - 52303149
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||| ||||| ||| ||||||| |||||||| ||||||||||||| |||||| |||| | ||||||||| ||||||    
T  52303226 tatccaaaagtcttagttcaactgacaaaatgctgaaattgttaggctggatgctatgatcggggttcgaatcccggt 52303149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 238582 - 238515
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||| | ||||||||||||||  |||| ||| ||||||||| ||||||||||||    
T  238582 agaagtcctagctcaactgtc-aaatgccgaaattgcaaggctggacgccatgacctgggttcgaaccc 238515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 18257333 - 18257396
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcga 374  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||    
T  18257333 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgatccgggttcga 18257396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 19849627 - 19849560
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | | ||| ||||||||||||||    
T  19849627 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaaccc 19849560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 43140030 - 43139963
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    |||||| |||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  43140030 agaagttctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 43139963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 358
Target Start/End: Original strand, 50501403 - 50501455
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    ||||||||| | ||||||||||||||||||| | |||||||||| ||||||||    
T  50501403 tatccagaaattctagctcaactggcaaaatactgaaattgttaagccggatg 50501455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 382
Target Start/End: Complemental strand, 54097065 - 54096993
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    |||||| ||| ||||| |||||||||||||||||| ||||  |||||| ||||||||  ||||||||||||||    
T  54097065 agaagtactaactcaagtggcaaaatgccgaaattattagatcggatgtcatgaccgacgttcgaaccccggt 54096993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 322 - 369
Target Start/End: Original strand, 35615899 - 35615946
Alignment:
Q  322 ctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||| ||||||| ||||||||||||||| |||| ||||||||||    
T  35615899 ctcaactgacaaaatgtcgaaattgttaggccagatgtcatgaccggg 35615946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 376
Target Start/End: Complemental strand, 53398418 - 53398347
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaac 376  Q
    |||||| ||||  |||||||||||||||||||  ||||||||||||| | ||| ||||||||| ||||||||    
T  53398418 tatccacaagttttagctcaactggcaaaatgttgaaattgttaggctgaatgtcatgaccggagttcgaac 53398347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2573927 - 2574005
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaa-ttgttaggccggatgccatgaccggg-ttcgaaccccggt 382  Q
    |||| ||||||||||||||||| || |||||| ||||| |||||||| |||||| ||||| |||| ||||||| |||||    
T  2573927 tatctagaagtcctagctcaacaggtaaaatgtcgaaatttgttaggtcggatgtcatgatcgggattcgaactccggt 2574005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 311 - 369
Target Start/End: Original strand, 8017853 - 8017911
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||| ||||||||||||  ||||||  |||||||||||||||||||  |||||||||    
T  8017853 agaagtactagctcaactgataaaatgttgaaattgttaggccggatgttatgaccggg 8017911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 310 - 379
Target Start/End: Original strand, 13218199 - 13218269
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaacccc 379  Q
    ||||| |||||| | |||||| |||||| | ||||||||||| |||||||||||| | |||||||||||||    
T  13218199 cagaaatcctagtttaactggaaaaatgtcaaaattgttaggtcggatgccatgatcggggttcgaacccc 13218269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 25726594 - 25726656
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||| ||||||||||| ||| || |||||| |||||||||||||| | ||||||||| ||||    
T  25726594 atccacaagtcctagcttaaccggtaaaatgacgaaattgttaggcagaatgccatgatcggg 25726656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Original strand, 11277986 - 11278030
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| ||||||||||||||  ||||||||    
T  11277986 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga 11278030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 316 - 379
Target Start/End: Original strand, 28758384 - 28758449
Alignment:
Q  316 tcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgaccgg-gttcgaacccc 379  Q
    |||||| ||||||||||||| |||||||||| ||||| |||| | ||||||||| |||||||||||    
T  28758384 tcctagttcaactggcaaaaatgccgaaattattaggtcggacgtcatgaccggagttcgaacccc 28758449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 319 - 382
Target Start/End: Complemental strand, 36860967 - 36860902
Alignment:
Q  319 tagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    |||||||||| |||||| |||||| |||||||||||||||| ||| ||  ||||||||||||||||    
T  36860967 tagctcaactagcaaaaatgccgatattgttaggccggatgtcataactggggttcgaaccccggt 36860902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 49870081 - 49870138
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga 364  Q
    ||||| |||| |||| ||||||| |||||||| ||||||||||  |||||||||||||    
T  49870081 atccacaagttctagttcaactgacaaaatgctgaaattgttataccggatgccatga 49870138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 375
Target Start/End: Original strand, 53457828 - 53457892
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaa 375  Q
    ||||||||||||||||||||| ||||||||||||||  ||| |||| | ||||| |||||||||||    
T  53457828 agaagtcctagctcaactggc-aaatgccgaaattgcaaggtcggacgtcatgacccgggttcgaa 53457892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 333 - 380
Target Start/End: Complemental strand, 16971785 - 16971737
Alignment:
Q  333 aaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||| ||||||||||||||||||  |||||| ||||||||||||||    
T  16971785 aaatgcccaaattgttaggccggatgttatgaccggggttcgaaccccg 16971737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 26424981 - 26424915
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  ||| |||| | ||||| ||||||||||||||    
T  26424981 agaagtcctagctcaactggc-aaatgccgaaattgcaagg-cggacgtcatgacccgggttcgaaccc 26424915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 28798512 - 28798445
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||| ||||||||| ||||||||||||||  |||||||| | | ||| ||||||||||||||    
T  28798512 agaagtcctagttcaactggc-aaatgccgaaattgcaaggccggacgtcgtgacccgggttcgaaccc 28798445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 310 - 357
Target Start/End: Original strand, 32233613 - 32233661
Alignment:
Q  310 cagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggat 357  Q
    |||||||||||| |||||| |||||| |||||||||||||| |||||||    
T  32233613 cagaagtcctagttcaactcgcaaaaatgccgaaattgttatgccggat 32233661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 353
Target Start/End: Complemental strand, 32662725 - 32662685
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggcc 353  Q
    |||||||||||||||| |||||||||  |||||||||||||    
T  32662725 aagtcctagctcaactagcaaaatgctaaaattgttaggcc 32662685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 351
Target Start/End: Original strand, 34123408 - 34123452
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttagg 351  Q
    |||||||||||||||||||| ||| |||||| | |||||||||||    
T  34123408 atccagaagtcctagctcaattggtaaaatgtcaaaattgttagg 34123452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 313 - 345
Target Start/End: Original strand, 37913318 - 37913350
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaatt 345  Q
    |||||||||||||||||| ||||||||||||||    
T  37913318 aagtcctagctcaactgggaaaatgccgaaatt 37913350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 306 - 380
Target Start/End: Original strand, 38814580 - 38814656
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    |||||| |||||||| ||||| ||| |||| |||| || ||||||||  ||||||||||||| ||||||||||||||    
T  38814580 tatccacaagtcctaactcaattggtaaaaatgccaaatttgttaggttggatgccatgaccggggttcgaaccccg 38814656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 369
Target Start/End: Complemental strand, 42550518 - 42550490
Alignment:
Q  341 aaattgttaggccggatgccatgaccggg 369  Q
    |||||||||||||||||||||||||||||    
T  42550518 aaattgttaggccggatgccatgaccggg 42550490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 323 - 359
Target Start/End: Complemental strand, 54420274 - 54420238
Alignment:
Q  323 tcaactggcaaaatgccgaaattgttaggccggatgc 359  Q
    |||||||| |||||||||||||||||| |||||||||    
T  54420274 tcaactggtaaaatgccgaaattgttatgccggatgc 54420238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0287 (Bit Score: 66; Significance: 5e-29; HSPs: 1)
Name: scaffold0287
Description:

Target: scaffold0287; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 1188 - 1115
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccc 378  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  1188 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc 1115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0778 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0778
Description:

Target: scaffold0778; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 302 - 385
Target Start/End: Original strand, 812 - 896
Alignment:
Q  302 cacatatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    |||| ||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
T  812 cacacatctagaagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc 896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 4145 - 4065
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggtgcc 385  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||  |||||||||||||||||||    
T  4145 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaagccggatgccatgactggggttcgaaccccggtgcc 4065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 39442 - 39366
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  39442 atccagaagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 39366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 160445 - 160526
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggtgcc 385  Q
    ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  160445 tatccagaagtcctagctcaactggtaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcc 160526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0595 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0595
Description:

Target: scaffold0595; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 344 - 420
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||    
T  344 atccaaaagtcctagctcaactggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt 420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0061 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0061
Description:

Target: scaffold0061; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 307 - 382
Target Start/End: Complemental strand, 8988 - 8912
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||    
T  8988 atccagaagtcatagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgaggttcgaaccccggt 8912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 90567 - 90644
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| | ||||||||||||||||    
T  90567 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggcctgatgtcatgatcggggttcgaaccccggt 90644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0457 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0457
Description:

Target: scaffold0457; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 382
Target Start/End: Original strand, 6782 - 6854
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||    
T  6782 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaactccggt 6854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0515 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0515
Description:

Target: scaffold0515; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2476 - 2553
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||| || |||||||| ||||||| ||||||||||||||||||||| |||||| ||||||||||||||||    
T  2476 tatccagaagtcataactcaactgacaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggt 2553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0306 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0306
Description:

Target: scaffold0306; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 306 - 382
Target Start/End: Original strand, 2476 - 2553
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||||||||||| || |||||||| ||||||| ||||||||||||||||||||| |||||| ||||||||||||||||    
T  2476 tatccagaagtcataactcaactgacaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggt 2553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0122 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0122
Description:

Target: scaffold0122; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 311 - 368
Target Start/End: Complemental strand, 15721 - 15664
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg 368  Q
    ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||    
T  15721 agaagtcctagttcaactggcaaaatgccgaaattgttaggtcggatgccatgaccgg 15664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0122; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 311 - 369
Target Start/End: Original strand, 18058 - 18116
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||||||||| ||||||||||||||| |||||||||||| |||||||||||||| ||||    
T  18058 agaagtcctacctcaactggcaaaataccgaaattgttaagccggatgccatgatcggg 18116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0163 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: scaffold0163
Description:

Target: scaffold0163; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 365
Target Start/End: Complemental strand, 27048 - 26988
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac 365  Q
    ||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||    
T  27048 atatccataagttctagctcaactggcaaaatgcagaaattgttaggccggatgccatgac 26988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0163; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 369
Target Start/End: Complemental strand, 5595 - 5539
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    |||| ||||||||||||||| |||||||||||||||| | |||||| ||||| ||||    
T  5595 aagttctagctcaactggcagaatgccgaaattgttatgtcggatgtcatgatcggg 5539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0882 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0882
Description:

Target: scaffold0882; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 312 - 378
Target Start/End: Complemental strand, 3821 - 3754
Alignment:
Q  312 gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgac-cgggttcgaaccc 378  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||    
T  3821 gaagtcttagctcaactggcaaaatgccgaaattgttaggccggatgctatgactggggttcgaaccc 3754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0244 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0244
Description:

Target: scaffold0244; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 307 - 380
Target Start/End: Complemental strand, 7886 - 7812
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccg 380  Q
    ||||||||||| |||||||| |||||||||||||||||||||||  |||||| ||||||| ||||||||||||||    
T  7886 atccagaagtcttagctcaattggcaaaatgccgaaattgttagatcggatgtcatgaccggggttcgaaccccg 7812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 312 - 382
Target Start/End: Complemental strand, 93092 - 93021
Alignment:
Q  312 gaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaaccccggt 382  Q
    |||| ||||||||||| || |||||||||||||| |||||| ||||||||||||| ||||||||||||||||    
T  93092 gaagacctagctcaaccggtaaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggt 93021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 306 - 379
Target Start/End: Original strand, 64281 - 64355
Alignment:
Q  306 tatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgg-gttcgaacccc 379  Q
    |||||| || ||||||||||||||  ||||| | ||||||||||||||||||||||||||||| |||||||||||    
T  64281 tatccataaatcctagctcaactgataaaattctgaaattgttaggccggatgccatgaccggagttcgaacccc 64355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 313 - 363
Target Start/End: Original strand, 95154 - 95204
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatg 363  Q
    |||| |||| |||||||||||||||||||||||||||||||||||||||||    
T  95154 aagttctagttcaactggcaaaatgccgaaattgttaggccggatgccatg 95204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0242 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0242
Description:

Target: scaffold0242; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 377
Target Start/End: Original strand, 15060 - 15128
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacc 377  Q
    |||||||| |||||||||||  ||||||||||||||||||||||| ||| |||||||| ||||||||||    
T  15060 cagaagtcttagctcaactgataaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacc 15128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0242; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 377
Target Start/End: Original strand, 23895 - 23963
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg-ggttcgaacc 377  Q
    |||||||| |||||||||||  ||||||||||||||||||||||| ||| |||||||| ||||||||||    
T  23895 cagaagtcttagctcaactgataaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacc 23963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 378
Target Start/End: Original strand, 114256 - 114323
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||| |||||||| | ||||| ||||||||||||||    
T  114256 agaagtcctagctcaactggc-aaatgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc 114323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0548 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0548
Description:

Target: scaffold0548; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 332 - 382
Target Start/End: Original strand, 6772 - 6822
Alignment:
Q  332 aaaatgccgaaattgttaggccggatgccatgaccgggttcgaaccccggt 382  Q
    ||||||||||||||||||||||||||| |||||| |||||||||| |||||    
T  6772 aaaatgccgaaattgttaggccggatgtcatgacggggttcgaactccggt 6822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 382
Target Start/End: Original strand, 195739 - 195816
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaa-tgccgaaattgttaggccggatgccatgac-cgggttcgaaccccggt 382  Q
    ||||||||||||||| |||||| |||||| || |||||||||||||||||||  ||||||  ||||||||||||||||    
T  195739 atccagaagtcctagttcaactagcaaaaatgtcgaaattgttaggccggatttcatgactggggttcgaaccccggt 195816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 379
Target Start/End: Original strand, 411647 - 411720
Alignment:
Q  307 atccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgacc-gggttcgaacccc 379  Q
    |||| ||||| ||| |||||||||||||||| | ||||||||||| |||||| ||||||| |||||||||||||    
T  411647 atcctgaagttctaactcaactggcaaaatgtcaaaattgttaggtcggatgtcatgaccggggttcgaacccc 411720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1348 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold1348
Description:

Target: scaffold1348; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 378
Target Start/End: Complemental strand, 986 - 919
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccc 378  Q
    ||||||||||||||||||||| ||||||||||||||  |||||||| | ||||| ||||||||||||||    
T  986 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc 919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0633 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0633
Description:

Target: scaffold0633; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 351
Target Start/End: Complemental strand, 3918 - 3880
Alignment:
Q  313 aagtcctagctcaactggcaaaatgccgaaattgttagg 351  Q
    |||||||||||||||||| ||||||||||||||||||||    
T  3918 aagtcctagctcaactggtaaaatgccgaaattgttagg 3880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0098 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0098
Description:

Target: scaffold0098; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 4682 - 4732
Alignment:
Q  319 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggg 369  Q
    ||||||||| || |||||||| ||||||||| |||||||||||||||||||    
T  4682 tagctcaaccggtaaaatgccaaaattgttaagccggatgccatgaccggg 4732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0070 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0070
Description:

Target: scaffold0070; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 329 - 382
Target Start/End: Original strand, 42073 - 42127
Alignment:
Q  329 ggcaaaatgccgaaattgttaggccggatgccatga-ccgggttcgaaccccggt 382  Q
    ||||||||||| |||||||||||||||| ||||||| | ||||||||||||||||    
T  42073 ggcaaaatgccaaaattgttaggccggacgccatgatcggggttcgaaccccggt 42127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0364 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0364
Description:

Target: scaffold0364; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 310 - 367
Target Start/End: Original strand, 11980 - 12037
Alignment:
Q  310 cagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    |||||||| |||||||| ||| |||||| ||||||| |||| ||||||||||||||||    
T  11980 cagaagtcgtagctcaattggtaaaatgtcgaaattattagaccggatgccatgaccg 12037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0067 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0067
Description:

Target: scaffold0067; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 356
Target Start/End: Original strand, 34819 - 34866
Alignment:
Q  308 tccagaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    |||||||||||||||||||||||| ||||||||||||||  ||||||||    
T  34819 tccagaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga 34866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0795 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0795
Description:

Target: scaffold0795; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 320 - 358
Target Start/End: Original strand, 1072 - 1110
Alignment:
Q  320 agctcaactggcaaaatgccgaaattgttaggccggatg 358  Q
    ||||||||||| |||||||||||||||||||| ||||||    
T  1072 agctcaactggtaaaatgccgaaattgttaggtcggatg 1110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 305 - 367
Target Start/End: Original strand, 2158 - 2220
Alignment:
Q  305 atatccagaagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccg 367  Q
    |||||||  |||| |||||||||||||| || || |||||||||||| || ||||||||||||    
T  2158 atatccacgagtcttagctcaactggcagaacgctgaaattgttaggtcgaatgccatgaccg 2220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 356
Target Start/End: Complemental strand, 10097 - 10053
Alignment:
Q  311 agaagtcctagctcaactggcaaaatgccgaaattgttaggccgga 356  Q
    ||||||||||||||||||||| ||||||||||||||  ||||||||    
T  10097 agaagtcctagctcaactggc-aaatgccgaaattgcaaggccgga 10053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University