View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0855_low_42 (Length: 214)

Name: NF0855_low_42
Description: NF0855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0855_low_42
NF0855_low_42
[»] chr4 (2 HSPs)
chr4 (55-134)||(49542656-49542733)
chr4 (1-57)||(49542559-49542615)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 55 - 134
Target Start/End: Original strand, 49542656 - 49542733
Alignment:
Q  55 gccagccagaagtgctcacccggtgatggcgtcacactgccttctcttgtcactgttttttactctcaattctctctgct 134  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||    
T  49542656 gccagccagaagtgctcacgcggtgatggcgtcacactgccttctcttgtcactgtttttta--ctcaattctctctgct 49542733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 49542559 - 49542615
Alignment:
Q  1 actggctatttcatgtacaatagttaaaattataaatcaccgatttctcctcatgcc 57  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  49542559 actggctatttcatgtacaatagttaaaattataaatcaccaatttctcctcatgcc 49542615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University