View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0849_low_44 (Length: 251)

Name: NF0849_low_44
Description: NF0849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0849_low_44
NF0849_low_44
[»] chr7 (2 HSPs)
chr7 (121-251)||(41876853-41876983)
chr7 (30-68)||(41876991-41877029)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 121 - 251
Target Start/End: Complemental strand, 41876983 - 41876853
Alignment:
Q  121 tttggtaccgtttgaattacaataaaatgttatttataaattcaaataaatggtatgtaaaatactcaagttgtataaattttgaattaattcaaatata 220  Q
    |||||| |||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  41876983 tttggtgccgtttaaattacaataaaatattatttgtaaattcaaataaatggtatgtaaaatactcaagttgtataaatttcgaattaattcaaatata 41876884  T
Q  221 ttttatttcaaattagtaaatgctagtagca 251  Q
    |||||||| ||||||||||||||||||||||    
T  41876883 ttttattttaaattagtaaatgctagtagca 41876853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 41877029 - 41876991
Alignment:
Q  30 caaatttcttaaaataaattgagatgcagggatcaaacc 68  Q
    |||||||||||||||||||||||||| |||||| |||||    
T  41877029 caaatttcttaaaataaattgagatgtagggataaaacc 41876991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University