View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0846_low_193 (Length: 252)

Name: NF0846_low_193
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0846_low_193
NF0846_low_193
[»] chr5 (1 HSPs)
chr5 (52-252)||(38629813-38630013)


Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 52 - 252
Target Start/End: Complemental strand, 38630013 - 38629813
Alignment:
Q  52 ggagcaacaaaagatacgaaccaatgcatagagaactaggtgcatttatgtccaattgtaggtctctttcttttctttctcaaattctagttacaatcta 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38630013 ggagcaacaaaagatacgaaccaatgcatagagaactaggtgcatttatgtccaattgtaggtctctttcttttctttctcaaattctagttacaatcta 38629914  T
Q  152 gcttttatacggaggcaaaccaatatatttgctaatagttattagagaaagaagagaagatgattacgagattacttgagtcacaagctagctactatta 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38629913 gcttttatacggaggcaaaccaatatatttgctaatagttattagagaaagaagagaagatgattacgagattacttgagtcacaagctagctactatta 38629814  T
Q  252 a 252  Q
    |    
T  38629813 a 38629813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University