View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0846_high_110 (Length: 322)

Name: NF0846_high_110
Description: NF0846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0846_high_110
NF0846_high_110
[»] chr1 (1 HSPs)
chr1 (74-193)||(6738786-6738900)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 74 - 193
Target Start/End: Complemental strand, 6738900 - 6738786
Alignment:
Q  74 cacagaaatgcataatgtgtgataataagagctcaaaatgggagagggaaataacaaattataaagatagctttgaagtcacctaaattgaaatgagcag 173  Q
    |||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||    
T  6738900 cacagaaatgcataatgtgtgataa---gagctcaaaatgggagagggaaataacaaattata--gatagctttgaagtcacctaaattgaaatgagcag 6738806  T
Q  174 ttgaaatagttttacccttg 193  Q
    ||||||||||||||||||||    
T  6738805 ttgaaatagttttacccttg 6738786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University