View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0845_low_43 (Length: 262)

Name: NF0845_low_43
Description: NF0845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0845_low_43
NF0845_low_43
[»] chr3 (2 HSPs)
chr3 (1-75)||(46680884-46680958)
chr3 (1-75)||(46676902-46676976)
[»] chr2 (1 HSPs)
chr2 (28-75)||(2649527-2649574)
[»] chr1 (1 HSPs)
chr1 (16-74)||(6091105-6091163)


Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 46680884 - 46680958
Alignment:
Q  1 caacttcaagaattagatggtgaatctgctaggcttgcagattactttgatgtgattacaggaacaagcacaggt 75  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46680884 caacttcaagaattagacggtgaatctgctaggcttgcagattactttgatgtgattacaggaacaagcacaggt 46680958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 46676902 - 46676976
Alignment:
Q  1 caacttcaagaattagatggtgaatctgctaggcttgcagattactttgatgtgattacaggaacaagcacaggt 75  Q
    ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||    
T  46676902 caacttcaagaattagacggtgaatctgctaggctcgcagattactttgatgtgattacaggaactagcacaggt 46676976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 28 - 75
Target Start/End: Complemental strand, 2649574 - 2649527
Alignment:
Q  28 gctaggcttgcagattactttgatgtgattacaggaacaagcacaggt 75  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||    
T  2649574 gctaggcttgcaaattactttgatgtgattacaggaacaagcacaggt 2649527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 6091163 - 6091105
Alignment:
Q  16 gatggtgaatctgctaggcttgcagattactttgatgtgattacaggaacaagcacagg 74  Q
    |||||||||  ||| ||||||||||||||||||||||||||  |||||||||| |||||    
T  6091163 gatggtgaagatgcaaggcttgcagattactttgatgtgatctcaggaacaagtacagg 6091105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University