View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0843_low_16 (Length: 333)

Name: NF0843_low_16
Description: NF0843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0843_low_16
NF0843_low_16
[»] chr4 (3 HSPs)
chr4 (104-260)||(25585779-25585937)
chr4 (201-253)||(25600321-25600373)
chr4 (201-253)||(25590669-25590721)


Alignment Details
Target: chr4 (Bit Score: 124; Significance: 9e-64; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 104 - 260
Target Start/End: Complemental strand, 25585937 - 25585779
Alignment:
Q  104 gctaccattagttagttgaataaatacctaagaatttcttcggctgtg--aaatatttctcaattattatgagaccagctgttttttatgtacatcgatg 201  Q
    |||| |||||||||||||||||||||||||||| ||||||| ||||||  ||||||||||||||||||||||||||||||||||||||||||||| |  |    
T  25585937 gctagcattagttagttgaataaatacctaagagtttcttcagctgtgtgaaatatttctcaattattatgagaccagctgttttttatgtacattgcag 25585838  T
Q  202 acaactatagaagaaagtaagggatcagatgctccactaatatcagcacctttgcttct 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25585837 acaactatagaagaaagtaagggatcagatgctccactaatatcagcacctttgcttct 25585779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 201 - 253
Target Start/End: Complemental strand, 25600373 - 25600321
Alignment:
Q  201 gacaactatagaagaaagtaagggatcagatgctccactaatatcagcacctt 253  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  25600373 gacaactatcgaagaaagtaagggatcagatgctccactaatatcagcacctt 25600321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 201 - 253
Target Start/End: Complemental strand, 25590721 - 25590669
Alignment:
Q  201 gacaactatagaagaaagtaagggatcagatgctccactaatatcagcacctt 253  Q
    ||||||||| || ||||||||||||||||||||||||||||||||||||||||    
T  25590721 gacaactatcgaggaaagtaagggatcagatgctccactaatatcagcacctt 25590669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University