View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0841_low_104 (Length: 224)

Name: NF0841_low_104
Description: NF0841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0841_low_104
NF0841_low_104
[»] chr7 (1 HSPs)
chr7 (104-210)||(22047339-22047445)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 104 - 210
Target Start/End: Original strand, 22047339 - 22047445
Alignment:
Q  104 aatttgtaaaaatgtttggctaaactgaaccatcaatatctctgcttattaatgaaatagtagtattggaaaaattaagtggtatatggcatgcttggtt 203  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  22047339 aatttgtaaaaatgtttggctaatctgaaccatcaatatctctgcttattaatgaaatagcagtattggaaaaattaagtggtatatggcatgcttggtt 22047438  T
Q  204 ttatttt 210  Q
    |||||||    
T  22047439 ttatttt 22047445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University