View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0840_high_18 (Length: 240)

Name: NF0840_high_18
Description: NF0840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0840_high_18
NF0840_high_18
[»] chr2 (1 HSPs)
chr2 (1-80)||(35332583-35332662)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 35332583 - 35332662
Alignment:
Q  1 ttgtaggtttgaagacggcactttgactcactcttactgtttttctcactcaggtttttgtttctggcgcgtacaataag 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35332583 ttgtaggtttgaagacggcactttgactcactcttactgtttttctcactcaggtttttgtttctggcgcgtacaataag 35332662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University