View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0830_high_70 (Length: 347)

Name: NF0830_high_70
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0830_high_70
NF0830_high_70
[»] chr6 (1 HSPs)
chr6 (18-111)||(894284-894377)
[»] scaffold0179 (3 HSPs)
scaffold0179 (135-243)||(6462-6570)
scaffold0179 (18-106)||(6343-6436)
scaffold0179 (301-333)||(6629-6661)


Alignment Details
Target: chr6 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 894377 - 894284
Alignment:
Q  18 gatccctggtggtaacaaagcactttcatggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctctcttgc 111  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  894377 gatccctggtggtaacaaatgactttcatggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctctcttgc 894284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 135 - 243
Target Start/End: Original strand, 6462 - 6570
Alignment:
Q  135 tccattcctctcctttctcctctaggataannnnnnnncttctccttttcgcttactaatctttttatagactctatcaatgaatccaccactctcaaca 234  Q
    ||||| |||||||||||||||||||||||         ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
T  6462 tccatccctctcctttctcctctaggatattttttttccttctccttttcgcttattaatctttttatagactctatgaatgaatccaccactctcaaca 6561  T
Q  235 ccctgaaaa 243  Q
    |||| ||||    
T  6562 ccctcaaaa 6570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 6343 - 6436
Alignment:
Q  18 gatccctggtggtaacaaa-----gcactttcatggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctct 106  Q
    |||||||||||||||||||     ||||||||||||||  | |||||| ||||||||||||||| |||||||||||||||||||||||||||||    
T  6343 gatccctggtggtaacaaattaaagcactttcatggttgttggattccactaccattgcaatattgtggtaaaattatatcttatttcttctct 6436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 333
Target Start/End: Original strand, 6629 - 6661
Alignment:
Q  301 gggtgtttgattattggtgaatttgtgtctgtg 333  Q
    |||||||||||||||||||||||||||||||||    
T  6629 gggtgtttgattattggtgaatttgtgtctgtg 6661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University