View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0829_low_111 (Length: 212)

Name: NF0829_low_111
Description: NF0829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0829_low_111
NF0829_low_111
[»] chr1 (1 HSPs)
chr1 (1-133)||(22102213-22102345)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 22102345 - 22102213
Alignment:
Q  1 gaatgaactagagaagtaattgaatttgacaattgacacagatgtcttaaattaggtataaaaagatgaacttatttagaatatactttaattcaatgca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  22102345 gaatgaactagagaagtaattgaatttgacaattgacacagatgtcttaaattaggtataaaaagatgaacttatttagaatatactttaatttaatgca 22102246  T
Q  101 tatcaattctcatgtacataaatctggtctctg 133  Q
    ||||||||||||||||||| | |||||||||||    
T  22102245 tatcaattctcatgtacattactctggtctctg 22102213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University