View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0826_low_7 (Length: 292)

Name: NF0826_low_7
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0826_low_7
NF0826_low_7
[»] chr7 (2 HSPs)
chr7 (126-241)||(49007507-49007622)
chr7 (70-130)||(49007671-49007735)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 126 - 241
Target Start/End: Complemental strand, 49007622 - 49007507
Alignment:
Q  126 tatgtctaaacaaagtctttcgtatttattattgattaagctatcaataaatgagatacttcgataatattacccatggtgttccattgtggagagtttc 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49007622 tatgtctaaacaaagtctttcgtatttattattgattaagctatcaataaatgagatacttcgataatattacccatggtgttccattgtggagagtttc 49007523  T
Q  226 aagcactggttctctg 241  Q
    |||||||||| |||||    
T  49007522 aagcactggtcctctg 49007507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 70 - 130
Target Start/End: Complemental strand, 49007735 - 49007671
Alignment:
Q  70 agcagcaactgttattaccta----agataaagttagttaattgttagtaaagggtgagttatgt 130  Q
    |||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||    
T  49007735 agcagcaactgttattacctattagagataaagttagttaattgttagtaaagggtgagttatgt 49007671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University