View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0826_low_3 (Length: 477)

Name: NF0826_low_3
Description: NF0826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0826_low_3
NF0826_low_3
[»] chr7 (3 HSPs)
chr7 (279-400)||(25527879-25528000)
chr7 (124-219)||(25527724-25527819)
chr7 (124-212)||(25535753-25535841)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 3e-55; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 279 - 400
Target Start/End: Original strand, 25527879 - 25528000
Alignment:
Q  279 tggcgacagagtgacattgttgagtttgaaaccctaaaatttcgtactttctaatttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat 378  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  25527879 tggcgaaagagtgacattgttgagtttgaaaccctaaaatttcgtactttctattttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat 25527978  T
Q  379 atatactacccccagcagaatt 400  Q
    |||||||||| |||||||||||    
T  25527979 atatactaccaccagcagaatt 25528000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 124 - 219
Target Start/End: Original strand, 25527724 - 25527819
Alignment:
Q  124 cagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctggggctccgccgttgctgcttgtt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  25527724 cagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctgaggctccgccgttgctgcttgtt 25527819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 124 - 212
Target Start/End: Original strand, 25535753 - 25535841
Alignment:
Q  124 cagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctggggctccgccgttgct 212  Q
    |||||||||||||||||||||||||||||||||| ||  |||| |||||||||||||||||||||||||||||||||||||||||||||    
T  25535753 cagaggcagcgtcgaggttgccggagcgaatcaacgatctgacgcgcgtgtggagttcttcaggaggaggctggggctccgccgttgct 25535841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University