View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0822_low_7 (Length: 265)

Name: NF0822_low_7
Description: NF0822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0822_low_7
NF0822_low_7
[»] chr3 (4 HSPs)
chr3 (4-85)||(21706584-21706665)
chr3 (17-75)||(21712812-21712870)
chr3 (17-68)||(21709483-21709534)
chr3 (49-77)||(21125479-21125507)
[»] chr7 (1 HSPs)
chr7 (210-260)||(35443214-35443264)


Alignment Details
Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 4 - 85
Target Start/End: Complemental strand, 21706665 - 21706584
Alignment:
Q  4 tatttcaagacttcttaattttggaagcattttgctcatagaaacagggaaaaggcttttcaacttgttgcagcctccgact 85  Q
    |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  21706665 tatttcaagactgcttaattttggaagcattttcctcatagaaacagggaaaaggcttttcaacttgttgcagcctccgact 21706584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 75
Target Start/End: Original strand, 21712812 - 21712870
Alignment:
Q  17 cttaattttggaagcattttgctcatagaaacagggaaaaggcttttcaacttgttgca 75  Q
    |||||||  |||||||||||   ||||| ||||||||||||||||||||||||||||||    
T  21712812 cttaattgcggaagcattttaaccatagcaacagggaaaaggcttttcaacttgttgca 21712870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 21709534 - 21709483
Alignment:
Q  17 cttaattttggaagcattttgctcatagaaacagggaaaaggcttttcaact 68  Q
    ||||||| ||||||||||||  |||||| |||| ||||||||||||||||||    
T  21709534 cttaattgtggaagcattttaatcatagtaacaaggaaaaggcttttcaact 21709483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 77
Target Start/End: Complemental strand, 21125507 - 21125479
Alignment:
Q  49 agggaaaaggcttttcaacttgttgcagc 77  Q
    |||||||||||||||||||||||||||||    
T  21125507 agggaaaaggcttttcaacttgttgcagc 21125479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 210 - 260
Target Start/End: Original strand, 35443214 - 35443264
Alignment:
Q  210 aaaaaaggtaaagaacacatgtgattcctctgtttattttcgcacaattct 260  Q
    ||||||||||||||||| | ||||||||| |||||||||||||| ||||||    
T  35443214 aaaaaaggtaaagaacaaaggtgattcctttgtttattttcgcaaaattct 35443264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University