View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0822_low_10 (Length: 218)

Name: NF0822_low_10
Description: NF0822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0822_low_10
NF0822_low_10
[»] chr7 (3 HSPs)
chr7 (1-58)||(32726599-32726656)
chr7 (6-56)||(35981034-35981084)
chr7 (6-56)||(36002446-36002496)
[»] chr2 (1 HSPs)
chr2 (5-56)||(26329630-26329681)


Alignment Details
Target: chr7 (Bit Score: 54; Significance: 3e-22; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 32726656 - 32726599
Alignment:
Q  1 aacacatggatatcaagatacaaatacttgtgatatttaggtttaagagattcttcct 58  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  32726656 aacacatggatatcaagatacaaatacttgcgatatttaggtttaagagattcttcct 32726599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 35981084 - 35981034
Alignment:
Q  6 atggatatcaagatacaaatacttgtgatatttaggtttaagagattcttc 56  Q
    ||||||||||||||||||||||||  ||||||||| ||||||  |||||||    
T  35981084 atggatatcaagatacaaatacttaagatatttagatttaagtaattcttc 35981034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 36002496 - 36002446
Alignment:
Q  6 atggatatcaagatacaaatacttgtgatatttaggtttaagagattcttc 56  Q
    ||||||||||||||||||||||||  ||||||||| ||||||  |||||||    
T  36002496 atggatatcaagatacaaatacttaagatatttagatttaagtaattcttc 36002446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 56
Target Start/End: Original strand, 26329630 - 26329681
Alignment:
Q  5 catggatatcaagatacaaatacttgtgatatttaggtttaagagattcttc 56  Q
    |||||||||||||||||||||||||| | ||||||| |||||| ||||||||    
T  26329630 catggatatcaagatacaaatacttgcgctatttagatttaagtgattcttc 26329681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University