View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0821_low_98 (Length: 239)

Name: NF0821_low_98
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0821_low_98
NF0821_low_98
[»] chr2 (1 HSPs)
chr2 (1-168)||(17833846-17834013)
[»] scaffold1463 (1 HSPs)
scaffold1463 (1-110)||(729-838)
[»] chr4 (1 HSPs)
chr4 (1-110)||(50231394-50231503)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 17833846 - 17834013
Alignment:
Q  1 tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgaggttggagaatgtgttccttacatgtgcaatgctgctta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||    
T  17833846 tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgagggtggagaatgtgttccttacatgtgcagtgctgctta 17833945  T
Q  101 acatttgatgatttagttttaccaagcctttgagattaacattggaatatgtggtcatctgtgctgct 168  Q
    |||| ||||| |||||||||| ||||||| |||||||||||||||||||||||||||| |||| ||||    
T  17833946 acatgtgatggtttagttttagcaagcctctgagattaacattggaatatgtggtcatttgtgttgct 17834013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1463 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: scaffold1463
Description:

Target: scaffold1463; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 729 - 838
Alignment:
Q  1 tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgaggttggagaatgtgttccttacatgtgcaatgctgctta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | | |||||||| ||||| || ||||||    
T  729 tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgagggtggagaacgggatccttacacgtgcagtgttgctta 828  T
Q  101 acatttgatg 110  Q
    ||||||||||    
T  829 acatttgatg 838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 50231503 - 50231394
Alignment:
Q  1 tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgaggttggagaatgtgttccttacatgtgcaatgctgctta 100  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||| ||||| | |||||||    
T  50231503 tcatgcagatttctatcgaggcatttcctcaaaattgttgcaaatttatcttggtggatgagggtggagaacgggttccttacacgtgcagttctgctta 50231404  T
Q  101 acatttgatg 110  Q
    ||||||||||    
T  50231403 acatttgatg 50231394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University