View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0818_high_69 (Length: 204)

Name: NF0818_high_69
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0818_high_69
NF0818_high_69
[»] chr1 (1 HSPs)
chr1 (20-117)||(59285-59382)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 59382 - 59285
Alignment:
Q  20 cttttatgtctccatttttagattcttgtttattggaagtttcagctataggatttcctgccctaagctctttttgcttcttcttctgcttcatctca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||    
T  59382 cttttatgtctccatttttagattcttgtttattggaagtttcagctatagaatttcctgccctaagctctttttgcttcttcttctgcttcttctca 59285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University