View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0818_high_62 (Length: 250)

Name: NF0818_high_62
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0818_high_62
NF0818_high_62
[»] chr3 (1 HSPs)
chr3 (1-76)||(7855750-7855825)


Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 7855750 - 7855825
Alignment:
Q  1 aagactcatatcgaattgctgtcttcagttgccacacttcttgtaggaatttgttcttgctccattgctttagatc 76  Q
    |||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  7855750 aagactcatatcaaatcgctgtcttcagttgccacacttcttgtaggaagttgttcttgctccattgctttagatc 7855825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University