View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0816_low_64 (Length: 343)

Name: NF0816_low_64
Description: NF0816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0816_low_64
NF0816_low_64
[»] chr1 (1 HSPs)
chr1 (64-265)||(1844457-1844658)


Alignment Details
Target: chr1 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 64 - 265
Target Start/End: Original strand, 1844457 - 1844658
Alignment:
Q  64 ctgatatgaaaaccttatagttataaaccacnnnnnnnnngtgatgtaatatgctcaactatatgctttttgaacatatgttctcaggtttacacaggtt 163  Q
    |||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1844457 ctgatatgaaaaccttatagttataaaccactttttttttgtgatgtaatatgctcaactatatgctttttgaacatatgttctcaggtttacacaggtt 1844556  T
Q  164 tatttgataaactgatacctttggagtatagtatgtnnnnnnnnttaagatactggtactctttcacttcagtatactctactctcacttcaaaatcctt 263  Q
    ||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1844557 tatttgataaactgatacctttggagtatagtatgtaaaaaaaattaagatactggtactctttcacttcagtatactctactctcacttcaaaatcctt 1844656  T
Q  264 tg 265  Q
    ||    
T  1844657 tg 1844658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University