View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0815_low_11 (Length: 322)

Name: NF0815_low_11
Description: NF0815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0815_low_11
NF0815_low_11
[»] chr6 (1 HSPs)
chr6 (96-247)||(27843978-27844130)


Alignment Details
Target: chr6 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 96 - 247
Target Start/End: Original strand, 27843978 - 27844130
Alignment:
Q  96 atcaatcaagcccttaaaatgcagcggcgtttgaaactcttgagggaaagctttgcggtcctatctagcttgaggacta-tctctacagttgtgcacaga 194  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||    
T  27843978 atcaatcaagcccttaaaatgcagtggcgtttgaaactcttgagggaaagctttgcggtcctatctagctttaggactagtctctacagttgtgcacaga 27844077  T
Q  195 taatacccaagtttacacccnnnnnnntaccagctttcaactaaggcaacagc 247  Q
    |||||||||||||||| |||       ||||||||||||||||||||||||||    
T  27844078 taatacccaagtttacccccaaaaaaataccagctttcaactaaggcaacagc 27844130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University