View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0814_low_63 (Length: 202)

Name: NF0814_low_63
Description: NF0814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0814_low_63
NF0814_low_63
[»] chr3 (1 HSPs)
chr3 (18-100)||(32989932-32990014)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 32990014 - 32989932
Alignment:
Q  18 cacgcgacgctgggacctctgatcaatggatcaaacggaacacctcaatgctccgtctgacaggaaaacaccccttcatctca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  32990014 cacgcgacgctgggacctctgatcaatggatcaaacggaacacctcaatgctccgtctgacaggaaaacaccccttcaactca 32989932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University