View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0812_low_174 (Length: 241)

Name: NF0812_low_174
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0812_low_174
NF0812_low_174
[»] chr2 (2 HSPs)
chr2 (1-117)||(40010857-40010973)
chr2 (144-233)||(40010985-40011074)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 40010857 - 40010973
Alignment:
Q  1 ttccacttggaaatgtttgattttaagaggataatcattttctctttcttttcgcatcaactatgttcaggaaatagaacgtcaagttcctttaatggat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||    
T  40010857 ttccacttggaaatgtttgattttaagaggataatcattttctctttcttttcgcctcgactatgttcaggaaatagaacgtcaagttcctttaatggat 40010956  T
Q  101 gaaatggacgcaaaggt 117  Q
    |||||||||||||||||    
T  40010957 gaaatggacgcaaaggt 40010973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 144 - 233
Target Start/End: Original strand, 40010985 - 40011074
Alignment:
Q  144 tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40010985 tcaatcttgctttttctatattggaataaataactttgcaaagtaatattgcaagtatgtaagtaaatacattacaaggtgctctgtgct 40011074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University