View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0812_low_130 (Length: 297)

Name: NF0812_low_130
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0812_low_130
NF0812_low_130
[»] chr6 (1 HSPs)
chr6 (32-231)||(3860469-3860669)
[»] chr3 (1 HSPs)
chr3 (45-114)||(47919409-47919478)


Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 32 - 231
Target Start/End: Original strand, 3860469 - 3860669
Alignment:
Q  32 ataaattttactctatgatgcagacagattcatataaatcaacaggatgttttgatctcacttgctctggatttgtgcaaacatccaatacagttgctct 131  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3860469 ataaattttactct--gatgcagacagattcatataaatcaacaggatgttttgatctcacttgctctggatttgtgcaaacatccaatacagttgctct 3860566  T
Q  132 tggtggtggcataaatcccatatcatctgactctggcacacaatatgaattaaatattggaatatacttggta---ataacaacattattttcttatatt 228  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||    
T  3860567 tggtggtggcataaaccccatatcatctgactctggcacacaatatgaattaaatattggaatatacttggtaattataacaacattattttcttatatt 3860666  T
Q  229 cat 231  Q
    |||    
T  3860667 cat 3860669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 114
Target Start/End: Complemental strand, 47919478 - 47919409
Alignment:
Q  45 tatgatgcagacagattcatataaatcaacaggatgttttgatctcacttgctctggatttgtgcaaaca 114  Q
    ||||||||||| |||| |||| || |||||||||||||||||||| ||||||   || ||||||||||||    
T  47919478 tatgatgcagaaagatacatacaagtcaacaggatgttttgatcttacttgcaagggttttgtgcaaaca 47919409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University