View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0809_low_188 (Length: 250)

Name: NF0809_low_188
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0809_low_188
NF0809_low_188
[»] chr1 (1 HSPs)
chr1 (1-233)||(6088626-6088858)
[»] chr3 (1 HSPs)
chr3 (1-134)||(46678056-46678189)


Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 6088858 - 6088626
Alignment:
Q  1 aaaatgcaggatgatacagtgacaggaatagattcttcagttgacattgctacagaggagaacttgaagaaactgtgccaaattggcgagaacttgttaa 100  Q
    |||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || || ||||    
T  6088858 aaaatgcaggatgatacattgacaggaatcgattcttcagttgacattgctacagaggagaacttgaagaaactgtgccaaattggtgaaaatttattaa 6088759  T
Q  101 agaaaccggtctctagagtcaatttggaaaatggccactttgagccactgacaaatggagaaaccaatgaagatgctctcaagaggtaattaagattaac 200  Q
    ||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||     
T  6088758 agaaaccggtctctagagtcaatttagaaaatggtcactttgagccactgacaaatggagaaaccaatgaagaagctctcaagaggtaattaagataaat 6088659  T
Q  201 cagtagtgatggtacattttaattaccactcaa 233  Q
     ||||| || |||||||||||||||||||||||    
T  6088658 tagtagagacggtacattttaattaccactcaa 6088626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 46678056 - 46678189
Alignment:
Q  1 aaaatgcaggatgatacagtgacaggaatagattcttcagttgacattgctacagaggagaacttgaagaaactgtgccaaattggcgagaacttgttaa 100  Q
    |||||||||||||||||| |||| || | ||||||||| ||||| ||| | ||| | ||||| ||  | ||||| ||||||||||| || |  ||||| |    
T  46678056 aaaatgcaggatgatacattgaccggtacagattcttcggttgatatttccacaaaagagaatttagaaaaactttgccaaattggtgacagattgttga 46678155  T
Q  101 agaaaccggtctctagagtcaatttggaaaatgg 134  Q
    ||||||| || ||||  |||||||| || |||||    
T  46678156 agaaaccagtatctaaggtcaatttagagaatgg 46678189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University