View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0804_low_26 (Length: 225)

Name: NF0804_low_26
Description: NF0804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0804_low_26
NF0804_low_26
[»] chr6 (1 HSPs)
chr6 (39-130)||(11226960-11227051)


Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 39 - 130
Target Start/End: Original strand, 11226960 - 11227051
Alignment:
Q  39 tcaagtgatgagatgtattatgggaaattggttgacatcatagaacttgattactatggtaagctgagggttgtgcttttcaagtgtatttg 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  11226960 tcaagtgatgagatgtattatgggaaattggttgacatcatagaacttgattactatggtaagctgagggttgtgcttttcaagtgtgtttg 11227051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University