View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0802_low_62 (Length: 221)

Name: NF0802_low_62
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0802_low_62
NF0802_low_62
[»] chr2 (1 HSPs)
chr2 (5-117)||(34379087-34379199)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 5 - 117
Target Start/End: Original strand, 34379087 - 34379199
Alignment:
Q  5 cttgcttctatatataccacttttctcattcgttcaatcatacaatcttctttctaaacattctcatatatcataagtctaataagtccttacctctttc 104  Q
    ||||||||||||||||||||||||||||||| ||  |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  34379087 cttgcttctatatataccacttttctcattcatttcatcacacaatcttctttctaaacattctcatatatcataagtcttataagtccttacctctttc 34379186  T
Q  105 tttcttgagtatt 117  Q
    |||||||||||||    
T  34379187 tttcttgagtatt 34379199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University