View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0798_low_16 (Length: 262)

Name: NF0798_low_16
Description: NF0798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0798_low_16
NF0798_low_16
[»] scaffold0168 (2 HSPs)
scaffold0168 (134-234)||(18551-18651)
scaffold0168 (1-66)||(18425-18490)


Alignment Details
Target: scaffold0168 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 134 - 234
Target Start/End: Original strand, 18551 - 18651
Alignment:
Q  134 ggagatgatagagcgttatttcaggtctcccccaacatttatgttctatattaagctaattgaattccaccatccatagctctgaatccaaacattgtct 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18551 ggagatgatagagcgttatttcaggtctcccccaacatttatgttctattttaagctaattgaattccaccatccatagctctgaatccaaacattgtct 18650  T
Q  234 t 234  Q
    |    
T  18651 t 18651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 18425 - 18490
Alignment:
Q  1 aatttcctatgtgataaaacgttgggaattatattttctttgcaattcaattgaaaaatggtgacg 66  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  18425 aatttcctatgtgataaaacgttgggaaatatattttctttgcaattcaattgaaaaatggtgacg 18490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University