View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0792_low_43 (Length: 226)

Name: NF0792_low_43
Description: NF0792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0792_low_43
NF0792_low_43
[»] chr8 (1 HSPs)
chr8 (1-129)||(44623060-44623188)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 44623188 - 44623060
Alignment:
Q  1 aagttttgaaacatgaatccaacttatattcatccacctttatattgtttctacatgcatctttcataatgtgaatacttgctacaatcaaatatgactc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44623188 aagttttgaaacatgaatccaacttatattcatccacctttatattgtttctacatgcatctttcataatgtgaatacttgctacaatcaaatatgactc 44623089  T
Q  101 tgaatgcttgaaaaaataaacaaattgat 129  Q
    |||||||||||||||||||||||||||||    
T  44623088 tgaatgcttgaaaaaataaacaaattgat 44623060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University