View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0791_low_94 (Length: 275)

Name: NF0791_low_94
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0791_low_94
NF0791_low_94
[»] chr3 (1 HSPs)
chr3 (68-223)||(54022290-54022445)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 68 - 223
Target Start/End: Complemental strand, 54022445 - 54022290
Alignment:
Q  68 catccgaatcttgttaaactacttggctactgttgggaggaaaatcaattcctgctggtttacgagtacatgcaaaagggcagcttggaaagccacctct 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54022445 catccgaatcttgttaaactacttggctactgttgggaggaaaatcaattcctgctggtttacgagtacatgcaaaagggcagcttggaaagccacctct 54022346  T
Q  168 tcagaagtacgaaattaattaatcaatagtatgtattagtattaagttaatgaatg 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54022345 tcagaagtacgaaattaattaatcaatagtatgtattagtattaagttaatgaatg 54022290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University