View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0791_low_70 (Length: 321)

Name: NF0791_low_70
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0791_low_70
NF0791_low_70
[»] chr1 (1 HSPs)
chr1 (39-218)||(52823762-52823941)


Alignment Details
Target: chr1 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 39 - 218
Target Start/End: Original strand, 52823762 - 52823941
Alignment:
Q  39 ttttgaacgggacgtcaataaacaaatgaaatgaaatgtgcacattatttattttattggttctgttcaactatgctttttgcaattaaaataaaaatat 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  52823762 ttttgaacgggacgtcaataaacaaatgaaatgaaatgtgcacattatttattttattggttctgttcaactatgatttttgcaattaaaataaaaatat 52823861  T
Q  139 attagtgcccccacaggcacagaccaagtggtggaggaatcaggtacgtacatacaaacagttctttctctataatatga 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52823862 attagtgcccccacaggcacagaccaagtggtggaggaatcaggtacgtacatacaaacagttctttctctataatatga 52823941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University