View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0791_low_128 (Length: 224)

Name: NF0791_low_128
Description: NF0791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0791_low_128
NF0791_low_128
[»] chr1 (1 HSPs)
chr1 (75-224)||(23522280-23522429)


Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 75 - 224
Target Start/End: Original strand, 23522280 - 23522429
Alignment:
Q  75 gtgggtagataatactattgagtttatagaaatggatgtgaatgaatggatccaaaaataagtgaaagggaggtggtactttgagaaggcaaaggcagtc 174  Q
    ||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23522280 gtgggtatatactactatagagtttatagaaatggatgtgaatgaatggatccaaaaataagtgaaagggaggtggtactttgagaaggcaaaggcagtc 23522379  T
Q  175 ttgtggcgattgtcaggcaattcactctgagatggatcagacccaattgt 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23522380 ttgtggcgattgtcaggcaattcactctgagatggatcagacccaattgt 23522429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University