View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_low_68 (Length: 320)

Name: NF0784_low_68
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_low_68
NF0784_low_68
[»] chr8 (1 HSPs)
chr8 (97-241)||(28347296-28347440)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 97 - 241
Target Start/End: Complemental strand, 28347440 - 28347296
Alignment:
Q  97 aacatgcaccttcttatctcaatggttatgtttgtcctacatgacaaaacattcatactacttcatcccatcataaatattctattcannnnnnnngtca 196  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||        ||||    
T  28347440 aacatgcaccttcttatctcaatggttatgtttgtcctacatcacaaaacattcatactacttcatcccatcataaatattctattcatattttttgtca 28347341  T
Q  197 tatgatgataatttatctaatgctcaccctcgttttgttgtctct 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  28347340 tatgatgataatttatctaatgctcaccctcgttttgttgtctct 28347296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University