View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_low_149 (Length: 221)

Name: NF0784_low_149
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_low_149
NF0784_low_149
[»] chr3 (1 HSPs)
chr3 (1-125)||(19140090-19140214)


Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 19140090 - 19140214
Alignment:
Q  1 atgaagtttcattcttttcaactctagtaaaaccttttgcaaagtgtcttatataattaaattattcatataagaaagagtgtaatgtaaatgtaaagtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19140090 atgaagtttcattcttttcaactctagtaaaaccttttgcaaagtgtcttatataattaaattattcatataagaaagagtgtaatgtaaatgtaaagtt 19140189  T
Q  101 tcttttctaatgaaatttccaaaat 125  Q
    |||||||||||||||||||||||||    
T  19140190 tcttttctaatgaaatttccaaaat 19140214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University